For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:27113699-27113795 97bp AGGCGGATGCCTAGTCTGT GCCTCTATGCAAAGCCACTA |
Mutant= 96 bp
Wild Type = 97 bp
Common Forward Primer (62628) anneals over the sequence containing genomic variation rs257721679.
Sequence
Large deletion: Mutant sequence with junction in uppercase
aggcggatgcctagtctgtggtgaacacattctgggggattgccttctCGgcacagactctccctggaagcagatggagtccaccttcccagatca
This mutation is a 3410 bp deletion beginning at Chromosome 2 position 27,110,337 bp and ending after 27,113,746 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 62628 | AGG CGG ATG CCT AGT CTG T | Common | A | |||
| 62629 | GCC TCT ATG CAA AGC CAC TA | Wild type Reverse | A | |||
| 62631 | Fluorophore-1 | CTT CTC CCT CTT GAT GGT CTT GTA GA | Quencher-1 | WT Probe | ||
| 62632 | Fluorophore-2 | ATT GCC TTC TCG GCA CAG ACT C | Quencher-2 | MUT Probe | ||
| 63891 | TGA TCT GGG AAG GTG GAC TC | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 62628 | 0.40 uM |
| 62629 | 0.40 uM |
| 63891 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.