Protocol 43692: Probe Assay - Saa4<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  130 bp

Wild Type = 129 bp

  
>chr7:46731559-46731687 129bp GCCACCGTCATTGTCCTCT TCAGAGGAAGTCAGTTAAACATGG

Sequence

Large deletion:  Mutant sequence with junction in uppercase

ggctggctgaaactcctaaagcctgtttctgttatctttgtagtaataattcagagatgaacaaatGGgttagtctgcagaatgtggtagtgagtcactctgagataactgtaaatctatccccacatcg

 

This mutation is a 4149 bp deletion beginning at Chromosome 7 position 46,727,816 bp and ending after 46,731,964 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
63723 GCC ACC GTC ATT GTC CTC T Wild type Forward A
63724 TCA GAG GAA GTC AGT TAA ACA TGG Wild type Reverse A
63725 GGC TGG CTG AAA CTC CTA AA Mutant Forward A
63726 CGA TGT GGG GAT AGA TTT ACA Mutant Reverse A
63727 Fluorophore-1 TGA TGG CTG GTA TTC ATT CTT CA Quencher-1 WT Probe
63728 Fluorophore-2 AGA TGA ACA AAT GGG TTA GTC TGC AG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
63723 0.40 uM
63724 0.40 uM
63725 0.40 uM
63726 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.