For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:49969587+49969704 118bp TGGCCATTATCTGTGAGTGAAC TGCAGAGAAGACCCTAGACG
Mutant= 120 bp
Wild Type = 118 bp
The common reverse primer (primer 63715) anneals over the nucleotide sequence containing mouse genomic variation rs246493443.
Sequence
Wt Sequence: TGGCCATTATCTgtgagtgaacttgcccaggcctcgaataccctgtgtgaggaccgccagAcaggtgaaagtggacacggctggcaggagggggtgcacgtctagggtcttctctgca
MUT Seq:
gaacggaaaagcaatacaagctattggaagagggggggaaagtagtacacaaatttgtaaaTAcaggtgaaagtggacacggctggcaggagggggtgcacgtctagggtcttctctgca
A 2685 bp deletion beginning at Chromosome 11 position 49,966,962 bp and ending after 49,969,646 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 63715 | TGC AGA GAA GAC CCT AGA CG | Common | A | |||
| 63716 | TGG CCA TTA TCT GTG AGT GAA C | Wild type Forward | A | |||
| 63717 | GAA CGG AAA AGC AAT ACA AGC | Mutant Forward | A | |||
| 63718 | Fluorophore-1 | TGA GGA CCG CCA GAC AG | Quencher-1 | WT Probe | ||
| 63719 | Fluorophore-2 | AGT AGT ACA CAA ATT TGT AAA TAC AGG TGA AAG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 63715 | 0.40 uM |
| 63716 | 0.40 uM |
| 63717 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.