For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:31497041+31497155 115bp AGCCCTCGGATTAAAGGTGT TTTTCTTATCCCTTCCTCCACA
Mutant= 90 bp
Wild Type = 115 bp
The common forward primer (primer 63710) anneals over the nucleotide sequence containing mouse genomic variation rs217515366.
Sequence
Wt Sequence: agccctcggattaaaggtgtttgccaccacgccctggagcgaaacattcttCctggggtactacttggcagttatctttagtcaggaagaaagtgtggaggaagggataagaaaa
MUT sequence: agccctcggattaaaggtgtttgccaccacgccctggagcgaaacattcttCCtttcagaggaagacttgctcactgtttgaggaagtgc
A 2433 bp deletion beginning at Chromosome 5 position 31,497,093 bp and ending after 31,499,525 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 63710 | AGC CCT CGG ATT AAA GGT GT | Common | A | |||
| 63711 | TTT TCT TAT CCC TTC CTC CAC A | Wild type Reverse | A | |||
| 63712 | GCA CTT CCT CAA ACA GTG AGC | Mutant Reverse | A | |||
| 63713 | Fluorophore-1 | CTA CTT GGC AGT TAT CTT TAG TCA GG | Quencher-1 | WT Probe | ||
| 63714 | Fluorophore-2 | AAA CAT TCT TCC TTT CAG AGG AAG AC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 63710 | 0.40 uM |
| 63711 | 0.40 uM |
| 63712 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.