For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 134 bp
Wild Type = 144 bp
>chr16:4938591+4938734 144bp CATCCCAACTCCTGTGATGTT CCACTGCCTATGAAATCATGC |
Large deletion: Mutant sequence with junction in uppercase
catcccaactcctgtgatgtttactgaacattaatcaatgtgccagagaggggcaaagcataagtaaggcttaggtcccCTggcagcttgaattgagctcttgtggtgatggtggagctgaaagcacaggccta
This mutation is a 2443 bp deletion beginning at Chromosome 16 position 4,938,671 bp and ending after 4,941,113 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
63685 | CAT CCC AAC TCC TGT GAT GTT | Common | A | |||
63686 | CCA CTG CCT ATG AAA TCA TGC | Wild type Reverse | A | |||
63687 | TAG GCC TGT GCT TTC AGC TC | Mutant Reverse | A | |||
63688 | Fluorophore-1 | CCT GTC ACT TGA GCT GGA GTC | Quencher-1 | WT Probe | ||
63689 | Fluorophore-2 | CCC TGG CAG CTT GAA TTG A | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
63685 | 0.40 uM |
63686 | 0.40 uM |
63687 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |