For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 134 bp
Wild Type = 144 bp
>chr16:4938591+4938734 144bp CATCCCAACTCCTGTGATGTT CCACTGCCTATGAAATCATGC |
Sequence
Large deletion: Mutant sequence with junction in uppercase
catcccaactcctgtgatgtttactgaacattaatcaatgtgccagagaggggcaaagcataagtaaggcttaggtcccCTggcagcttgaattgagctcttgtggtgatggtggagctgaaagcacaggccta
This mutation is a 2443 bp deletion beginning at Chromosome 16 position 4,938,671 bp and ending after 4,941,113 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 63685 | CAT CCC AAC TCC TGT GAT GTT | Common | A | |||
| 63686 | CCA CTG CCT ATG AAA TCA TGC | Wild type Reverse | A | |||
| 63687 | TAG GCC TGT GCT TTC AGC TC | Mutant Reverse | A | |||
| 63688 | Fluorophore-1 | CCT GTC ACT TGA GCT GGA GTC | Quencher-1 | WT Probe | ||
| 63689 | Fluorophore-2 | CCC TGG CAG CTT GAA TTG A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 63685 | 0.40 uM |
| 63686 | 0.40 uM |
| 63687 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.