For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 147 bp
Wild Type = 148 bp
>chr4:144419557-144419704 148bp GCTGCCCGAGAAGTCTGA CATCCCATTGCTCATGTAGGT |
Sequence
Wt Sequence (deletions in lower case):
TCAGATCCCAAAGCTGCACCCTGAGTGGCCCTGACAGTTTCCATTTAGCAGAGCATCCTGACTTGAATTTTACTTTACCATTGCAGTTTACCctggggatgaatggacttggccggagaggtgaaagcagctaacaagggtatataactgaaaggggaatggttccagtgagatagacagttctgtggcccttggaagtctctggtgaccaatggaggcttcctttccactggagatgcttgaaaggtggtcactgccctcacccttggctggaagggacagcttgctctgacggataatgtagcaactgtgtgtgtccttccagggtctcccgtacaagcacctgatcacccatcaccaggaaccttcgcatcgctatctgatcagcacctatgatgaccactacaacaggcacaattataacccaggcttgccagctctgcgtacctggaatggacagaaactgctgtggctgcccgagaagtctgactttccccttgttggtacatttataattggagtcccccccttcctgtgtttggtcaataagaggaccacagatgcACAGGGGTAAAGTGGGCTCCCATCACAGACAAAGACCTACATGAGCAATGGGATG
This mutation is a 472 bp deletion beginning at Chromosome 4 position 144,419,612 bp and ending after 144,420,083 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 63660 | GCT GCC CGA GAA GTC TGA | Wild type Forward | A | |||
| 63661 | CAT CCC ATT GCT CAT GTA GGT | Common | A | |||
| 63662 | TCA GAT CCC AAA GCT GCA C | Mutant Forward | A | |||
| 63663 | Fluorophore-1 | CAA TAA GAG GAC CAC AGA TGC AC | Quencher-1 | WT Probe | ||
| 63664 | Fluorophore-2 | ACC ATT GCA GTT TAC CAC AGG G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 63660 | 0.40 uM |
| 63661 | 0.40 uM |
| 63662 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.