For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr6:67015556+67015653 98bp GGTTTTGTAGATACTCTGGCACA TTGAAGGAGACTGGCTGCAT
Mutant= 97 bp
Wild Type = 98 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
actgattcgtgctaaatttctgcagaaaggttttgtagatactctggcacatctagatcgtcaccaaaattaCGgatggcgtgaggaaggtggggtgctgacatttatcgctatccttgcagcat
This mutation is a 5857 bp deletion beginning at Chromosome 6 position 67,015,601 bp and ending after 67,021,457 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 62653 | TTG AAG GAG ACT GGC TGC AT | Wild type Reverse | A | |||
| 62654 | ATG CTG CAA GGA TAG CGA TAA | Mutant Reverse | A | |||
| 62655 | Fluorophore-1 | ATT TCT GGC TGG GAT ATT TGG | Quencher-1 | WT Probe | ||
| 63347 | GGT TTT GTA GAT ACT CTG GCA CA | Common | A | |||
| 63519 | Fluorophore-2 | AGG AAG GTG GGG TGC TGA CA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 62653 | 0.40 uM |
| 62654 | 0.40 uM |
| 63347 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.