For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:111467361+111467482 122bp TGGCTAGCTGTTCTGTGACC GTGGCCTGCAACAGGAAA
Mutant= 127 bp
Wild Type = 122 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
tggctagctgttctgtgaccgagttacacttccagtgcctccttcagtcaacccagacgtCGggtgggtggggggtggtctatgaaaaggtagaatgggatgaatatcaactgcttctcagtgtgcg
This mutation is a 1922 bp deletion beginning at Chromosome 9 position 111,467,422 bp and ending after 111,469,343 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 63477 | TGG CTA GCT GTT CTG TGA CC | Common | A | |||
| 63478 | GTG GCC TGC AAC AGG AAA | Wild type Reverse | A | |||
| 63479 | CGC ACA CTG AGA AGC AGT TG | Mutant Reverse | A | |||
| 63480 | Fluorophore-1 | CCA GAC GTC CAA AGG ATT CTC | Quencher-1 | WT Probe | ||
| 63481 | Fluorophore-2 | CAG ACG TCG GGT GGG TGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 63477 | 0.50 uM |
| 63478 | 0.50 uM |
| 63479 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.