Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr7:24531128+24531224 97bp GGACTGAAGCCTGGATCTACA TCTGTCTCCCAGAGTGCTGA |
Mutant= 98 bp
Wild Type = 97 bp
Large deletion: Mutant sequence with junction in uppercase
ggactgaagcctggatctacagtgaatcagttagGGtagacaagcacatggatgccctctctcagtctggctctggattttagccacagggacgacagcaaatgtgatgca
This mutation is a 7630 bp deletion beginning at Chromosome 7 position 24,531,163 bp and ending after 24,538,792 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 63132 | GGA CTG AAG CCT GGA TCT ACA | Common | A | |||
| 63133 | TCT GTC TCC CAG AGT GCT GA | Wild type Reverse | A | |||
| 63134 | TGC ATC ACA TTT GCT GTC GT | Mutant Reverse | A | |||
| 63135 | Fluorophore-1 | ATC AGT TAG GAG AGG GTG TTG ATT G | Quencher-1 | WT Probe | ||
| 63136 | Fluorophore-2 | TGA ATC AGT TAG GGT AGA CAA GCA CA | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 63132 | 0.40 uM |
| 63133 | 0.40 uM |
| 63134 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.