For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 122 bp
Wild Type = 71 bp
>chr6:113075985-113076055 71bp GATCTGCAACTCCAGTCTTTCT ACACCAGGTTAGCCTTTAAGC
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 61347 | GAT CTG CAA CTC CAG TCT TTC T | Forward | A | |||
| 61348 | ACA CCA GGT TAG CCT TTA AGC | Reverse | A | |||
| 61349 | Fluorophore-1 | AGA AGA TGG GCG GGA GTC | Quencher-1 | WT Probe | ||
| 61350 | Fluorophore-2 | CAG TGG TGT ACG GTA CAA ACC GG | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 61347 | 0.40 uM |
| 61348 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
| Stock Number | Strain Name |
|---|---|
| 037406 | 129S1/SvImJ-Gt(ROSA)26Sorem12Mvw/Mmjax |
| 037407 | A/J-Gt(ROSA)26Sorem18Mvw/Mmjax |
| 028573 | C57BL/6J-Gt(ROSA)26Sorem2Mvw/Mmjax |
| 037409 | DBA/2J-Gt(ROSA)26Sorem14Mvw/Mmjax |
| 037410 | FVB/NJ-Gt(ROSA)26Sorem20Mvw/Mmjax |
| 037412 | NZO/HlLtJ-Gt(ROSA)26Sorem31Mvw/Mmjax |
| 037413 | PWK/PhJ-Gt(ROSA)26Sorem19Mvw/Mmjax |
| 7 strains use this protocol | |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.