For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:111841642-111841778 137bp GCTTAGAGTTTGGTGGGATAAAC TCCCTTAGTGAAGACATCTAGTTTG
Mutant= 147 bp
Wild Type = 137 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
GAACACAGACATACACATAAATAAATGAATAAATATCTCTAAAAAAATTAAATCTCAGTTTACCGTCTCCATCTCTCTTACTGTGTTATTAGTAATCCCAGATGTAAACTTTGAGGTGTGTAAGGTGatccatggattggggagaggcagtgagtgacttgcattctgtcttgtcttccttttcctgggtggctgttggtgagtaggaaaaggaaacaaagtggcctcttgttagaagaagaggaagatggcaaggaagactctggaggtagtagcagtgaagaagatgaagaggagcaagaaggaggccttgggtcagagaatgcaaggaagaagaaggaagatgagttgtgggccagcttccttaatgatgtaggaccaaagtcaaaagcagccccaggttcacaaactaaggtaagcttagagtttggtgggataaacacctttccagaaacgccctcacttccctgggagcTTCCTATTGTTTTAATTCGCAAACTGACTTGAAATTTGAATCTCAAATCAAAAAGCAAACTAGATGTCTTCACTAAGGGAAAAGCAAAGCATTGCTTTCTTTCTTTC
This is a 348 bp deletion beginning at Chromosome 8 position 111,841,722 bp and ending after 111,842,069 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52434 | GCT TAG AGT TTG GTG GGA TAA AC | Wild type Forward | A | |||
| 52435 | CCG TCT CCA TCT CTC TTA CTG T | Mutant Forward | A | |||
| 52437 | Fluorophore-1 | CTT TGA GGT GTG TAA GGT GGA TTC C | Quencher-1 | MUT Probe | ||
| 52674 | TCC CTT AGT GAA GAC ATC TAG TTT G | Common | A | |||
| 52677 | Fluorophore-2 | TTT CCA GAA ACG CCC TCA CT | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52434 | 0.40 uM |
| 52435 | 0.40 uM |
| 52674 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.