Protocol 37599: Probe Assay - Tdrd3<em1(IMPC)J>Alternate 1
Version 2.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr14:87487413+87487525 113bp CATGTCGCCAAAACATAGGA GGTTGGGTGGAGTACTTTGG

Mut = 137 bp

Wt = 108 bp

Fam = Mut

Hex = Wt

 

Sequence

MUT Sequence (junction in uppercase):

ttatgatgtctttatatcatctcattttcatctgcattgatacaCAtggaaagttagatgtacaaacagatagttgagttggaaaatttactgtagcatgacttcatattgcttacatcatttctgagattggtctgtctgttttcctcacatgt

This mutation is a 2230 bp deletion beginning at Chromosome 14 position 87,485,304 bp and ending after 87,487,533 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
50434 CAT GTC GCC AAA ACA TAG GA Wild type Forward A
50437 GGT TGG GTG GAG TAC TTT GG Wild type Reverse A
50440 Fluorophore-1 TGC ATT CTG AGA ACA AAG GCC Quencher-1 WT Probe
51756 TCA TCT CAT TTT CAT CTG CAT TG Mutant Forward A
51757 ATG TGA GGA AAA CAG ACA GAC CA Mutant Reverse A
51758 Fluorophore-2 CTG TAG CAT GAC TTC ATA TTG CTT ACA TCA Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
50434 0.40 uM
50437 0.40 uM
51756 0.40 uM
51757 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.