For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:104847907+104848043 137bp CCCTGGTAACAATGAGATGGA TGGATCTGTCCTGTATGTGTGT
Mut = 159 bp
Wt = 137 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CTGAACCCTGGTAACAATGAGATGGAAATTTCACAATCTGCTGGCAGCTGATTACAGAAAActaacccagaggcatctctccaccaggtcaggactcaccagaggccaaccccatcagaaacacacatacaggacagatccaaggcagccttatccacgtgaaggacactaaagctggtgtccacaccttcctgggaatcccctttgccaaacctcctgtaggaccactgcgatttgcacctcctgaggcccctgaaccatggagtggtgtgagagatggaactgcacatccggccatgtaagttttggacccagagggtttcaggcactgggggagaatgtactctgagctctgtgctatgctgaagtgtttcctccacctcagtgacacagcagttttctctctttgtggatgagtgccccatgggtttttctgatgatgtgctaatgttgattagaacaactgggccaggctcctaggtcagagcttggcactcatagggaataacatggatatactatggagaaaaACAAAGATAAAATTGTTCACACATTCCAATTAACCAAAGTGTTCTCTGCCACAATGGGTGCATCTCTAGGCATGAGTAAATGTCAC
This mutation is a 469 bp deletion beginning at Chromosome 8 position 104,847,963 bp and ending after 104,848,431 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51569 | CCC TGG TAA CAA TGA GAT GGA | Common | A | |||
| 51570 | TGG ATC TGT CCT GTA TGT GTG T | Wild type Reverse | A | |||
| 51571 | TGC TTG CTG CCT AAT ATG TGA | Mutant Reverse | A | |||
| 51572 | Fluorophore-1 | CCA GAG GCA TCT CTC CAC CA | Quencher-1 | WT Probe | ||
| 51573 | Fluorophore-2 | CTC TGC CAC AAT GGG TGC AT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51569 | 0.40 uM |
| 51570 | 0.40 uM |
| 51571 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.