For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr15:79794548-79794642 95bp GTTTTCGCTCCCTCTGCAT GGCGATCTTAGCTTCTGGTG
Mutant= 106 bp
Wild Type = 95 bp
Sequence
Wt Sequence (deletions in lower case):
CCGTTATGAGGTTGTTTGTGAGGGTTTTCGCTCCCTCTGCATGCAGGCTTTGCCTGTGCATACCCTGCCTGCCatagcttcactatctcagctttgcccaccagaagctaagatcgcctgtggtggccggcggggtggtggcacggctgtgtgacaccacatcaccatcctccctttccctttcgagcagcaggagctcccagcccgtgggaacatctcctcggcgccagctccagccatgcccaccgccctgcactccaagatggacgaactagaaggccagctgctggccaaggtgctggcgctggagaaggagcgagccgccctcagtcacgggagccaccagcaacgacaggaagtggagaaggagctgaatgccctgcagggtcgcgtggccgagctggagcacggtaggtcctgaggtgcagatggctgagctgcccggtcctggtctctggctggaacttccAGAGGCTGTAGAACAAGACAGGGAGAGCCTGCTGGGGGATGGCTGTCACTTTCAAAGTCACAGTTGTCATTTCTAGCTCTGCTGGGCCCCAGGGGCTGGCTGCCG
A 396 bp deletion beginning at Chromosome 15 position 79,794,197 bp and ending after 79,794,592 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49616 | GTT TTC GCT CCC TCT GCA T | Common | A | |||
| 49617 | GGC GAT CTT AGC TTC TGG TG | Wild type Reverse | A | |||
| 49618 | TTT GAA AGT GAC AGC CAT CC | Mutant Reverse | A | |||
| 51338 | Fluorophore-1 | CCT GCC TGC CAG AGG CTG TA | Quencher-1 | MUT Probe | ||
| 51339 | Fluorophore-2 | CCA TAG CTT CAC TAT CTC AGC TT | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 49616 | 0.50 uM |
| 49617 | 0.50 uM |
| 49618 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.