For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chrX:74371058-74371161 104bp AGGCAGCTGTGCTGAAAGAG TGCAAGCTTAGGAGCATGG
Mut = 101 bp
Wt = 104 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GAGGCAGCTGTGCTGAAAGAGGAGATGGCTGAATGACATTCaagggccagcattatttcaaaactagaggtaaaggtctgagagccccatgctcctaagcttgcaatttctcctcttcattaaccactttctttaccccttttcttttcaggaaaaaatcctgctatcaaggaagaaaatataggaccaggaccttcccatggacccttctcaggacattccaacagcacaagcaagggtgtctccctaagacacaagaggcctgaaaaaactatcctttgtgaagtgccatggtggtcaagaaaagcagaggtagctcccagcagttgcctggcctgggaggacagggtggttgtacaggttttgtaggcatgcttggaactgccctgctgttcatcagcctaccatggggagctcaagtgatggccagtgccaacatcagcactgctctgggccacacaagtggtcactatttgagtattggggatggctcagtgacagaatttgatttccctgagaagagtgagggtatcattgtgatctctagccaatacactggacagaccaatgggacaggccccagccccatacttaaggttatatccctggacacagaggtgctgaccattaagaatgtgagtgccataacctggagcagtggaggtggctttgtggtaggcatccactcaggtctagctgggctggccccactccacctccagctcatggatttctatgaggccccacccctgctgatcgaagaacggagagatttctgcatcagggtgtcacctgctgaagacctcccttctgctctcaacaccaacttgggccacttctcagagaacccaatactctacttgcttctgcctcttatctttgtcaacaagtgttcatttggttgcaaagtggaacttgaagttttgaaggagctcctacagagcccccaacccatgctgttgggcctcttgggccagtttctggtcatgcctttctatgctttcctgatggccaaagtcttcatgctacccaaggccttagctctgggcctcatcattacctgctcatcacctggtggtggagggagctacctcttcagtctcctccttggaggagatgtcaccctggccatctccatgactttcatctcaacagtagctgccactggtttcctaccactctcatcagccatctacagctaccttctcagcatccatgaaacactccacgtgcccatctccaagatattggggaccctgctgtttatcgccatccccatagcagcgggtgtggtgatcaaatctaagctccccaagttctctgaactactgttacaggtcatcaagcccttcagctttatacttctcctgggtggcctgttcctggcctaccacatgggggtcttcatcctagtgggagtcaggttacccattgtactggtgggtttcacagtgcctcttgttggcctcttggtgggctacagcctggccatctgcctgaagctgccagtggctcagcgacgaacagtcagcattgaggtaggggtgcaaaacagcctgctagccttagccatgctacagctgtctctgcgccgccttcaagcagactatgcctctcaggcccctttcattgtggcactgagtggtacctccgagatgttggctttggttattggccagttcatctatagcatcttgtttcctgttccctgagccctctggatcaagttttataacttccagcccccatactcctctcttcccacagttcttgtgtaccgtaccaaaggcctttagttctcatgcactatgcactcaagacaaatccaggcttatttttttactccttttcgccccagctttcagtgccaaagaggccatgctgagttagatagttgggtattgcccagaaatatatttcaataaaaaaaaaccaaaaaaacaaaagcaagctcgggtcccttccagtctgtcccttggagcctgtggattggggtaagaagagtgtgtctgggcggatatgggccagaacagtgaaccagcttggtgaccctgcacagaacccactttctcctcctcactctgttttgcacatggtagacatgtacctttgagctgtatcctcagatctacaaaggctttgctctaacagccctacctaacagggcagacctctgcACTATAAGGAGTGAAGAGAGCACTACTTCCGAGCTTCAGTCAGGATATTTTTGCAGCCAGACTAGAAAGGAAGTAGA
This mutation is a 2136 bp deletion beginning at Chromosome X position 74,368,986 bp and ending after 74,371,121 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51320 | AGG CAG CTG TGC TGA AAG AG | Common | A | |||
| 51321 | TGC AAG CTT AGG AGC ATG G | Wild type Reverse | A | |||
| 51322 | TCT GGC TGC AAA AAT ATC CTG | Mutant Reverse | A | |||
| 51323 | Fluorophore-1 | AGG GCC AGC ATT ATT TCA AAA C | Quencher-1 | WT Probe | ||
| 51324 | Fluorophore-2 | CAT TCA CTA TAA GGA GTG AAG AGA GCA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51320 | 0.40 uM |
| 51321 | 0.40 uM |
| 51322 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.