For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chrX:157818305+157818392 88bp AAGCTGAGCAGGCAAAAATC GCTGGAGGCATCCCATAAC
Mut = 118 bp
Wt = 88 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AGCCAAATCTGGATGAAGGAACCTTAGGTTTTAAGCTGAGCAGGCAAAAATCAGCCTTTGCTAGGGGCTCAGCAGCTGgacagcggaggtgggggttccgtgttatgggatgcctccagccgcgctgggctggctccatcccagcttcccgccttgggcatcatgagttacttcctgtcttactgcaaaacccacggcagctctcttctcactggctaccaggccctacgcgctgagggcttcttgtgcgacgtgacactggaggccgagggcagtgagttcccagcacacaggtcacttctggcgtgctccagcgactacttcagggccctgttcaagagtcacactcaggaatcgcgggctcgcgtaattcacctgcgtgtgccttcagcggccggcctacagcgcctgctggacttcatctacactgcctggctgcccctctccatggacactgtggaggacactctggaggctgccagctacctgcaagtcaccgaggccttgggactgtgtgcccactacttggaacgccagcttgccccagagaattgctgtttcattgccaatgtggcagctcgatttggcctggcccgcaccctaggtgcagcggagtgctgtattgtacgccacctggggggcctgttactgatgggcactggcccctcggggctgttggaactcaatcctatatcaatgaaagctgtgctgggcgcccctgacgtggcacgggtgcctgagacgcggctgctgggcctggcactagcctggctgcagcaggaacccaaggtccagcgcctggcacatagttcaacactgcttggatgcatccgctttggcctggtgcctgctggtgtgctgcggcgcatatactcgggctccggtcttatattacctactaggatcaaaagcctcatcatccaggccctcaattaccatacagcaccctccagccagccgcttctgcagggagaacagactagtgttcggagtccccagacccgtatcttgctagttggtggtctcagagctagggagatggttaccgaggagatcatgggcctaccagaggtagttcagaatcggcaccctgcacctcaaccagaggaagaggagggacaggaggaggaagagatggaggagaaggagtgggagctcacccaggatgtggtgtccttcgacgtgtataaccacagctggcacagcttgacacagctgcccacaccactgctaggccacagtgtatgtaccactggcaacttcctatttgtccttggaggggagagccttcctggcagcccatctagttccctggctgccggctcaaggtcaatcacagccttagtgcaccgttatgacccgcgcttccacacttggacacaggtgcctgccatgcgagaagcaagggcctacttctggtgtggtgtggtaggtgagagtctcctggctgtcggaggcctgggcatctgtggtgaggcactggcctcagtggagatgtatgaccttcgcagggaccgctggatggcagctggacagctacctcgggcagtacatggtcacgcaggtgctgtcggggatcatggtgttgtgtacatctccgggggcaaggctgggagaggtgaaggaggcacaagtagcctccgggatatgtactcccttagccccggagagagagtgtggagcaagagggcacccatgggcacagctcgctatgggcactaccttgtggtgctgcGAGGTGCAGTGTTTGCCTTTTTGGGGAGATATGAGCCCTTCTCTGAGATTGAACGCTATGACCCCTGCACAGACCAGTGGACTCGGTTGCGGTCGCTACCCTATGACCGCTTCTGCTATGGA
This mutation is a 1657 bp deletion beginning at Chromosome X position 157,818,351 bp and ending after 157,820,007 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50297 | AAG CTG AGC AGG CAA AAA TC | Common | A | |||
| 50298 | GCT GGA GGC ATC CCA TAA C | Wild type Reverse | A | |||
| 50299 | AGG GGT CAT AGC GTT CAA TC | Mutant Reverse | A | |||
| 50300 | Fluorophore-1 | CAG CGG AGG TGG GGG T | Quencher-1 | WT Probe | ||
| 50301 | Fluorophore-2 | AGC TGT CCA GCG AGG TGC A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50297 | 0.40 uM |
| 50298 | 0.40 uM |
| 50299 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.