For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 125 bp
Wild Type = 91 bp
>chrX:72820392-72820482 91bp TGTCATTATTGTTATAGACTGCATTTG CCTTCACTCCAACGAACTCAG
Sequence
Wt Sequence:
ttgaaaacttgtcattattgttatagactgcatttgtatttactaaaggactgtCAggaatcaggaacactagaatacactgagttcgttggagtgaaggagtttgagcacgaactttattctttacttctttcttgtgttttagAT
Mutant Sequence:
GAGCATTCTTAACATTTTACTCAGTTGAAAACTTGTCATTATTGTTATAGACTGCATTTGTATTTACTAAAGGACTGTCataacttcgtatagcatacattatacgaagttatAGGAATCAGGAACACTAGAATACACTGAGTTCGTTGGAGTGAAGGAGTTTGAGCACGAACTTTATTCTTTACTTCTTTCTTGTGTTTTAGAT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44808 | TGT CAT TAT TGT TAT AGA CTG CAT TTG | Forward | A | |||
| 44809 | CCT TCA CTC CAA CGA ACT CAG | Reverse | A | |||
| 44810 | Fluorophore-1 | TAA AGG ACT GTC AGG AAT CAG GAA | Quencher-1 | WT Probe | ||
| 44811 | Fluorophore-2 | TTA TAC GAA GTT ATA GGA ATC AGG AAC A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44808 | 0.40 uM |
| 44809 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.