For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chrX:142770869+142770978 110bp CATGTGGGCTGTTTTCCAC TGCATCTGTAACCTGGAGGA
Mutant= 85 bp
Wild Type = 110 bp
Sequence
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
A 340 bp deletion beginning at Chromosome X position 142,770,892 bp and ending after 142,771,231 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44376 | CAT GTG GGC TGT TTT CCA C | Common | A | |||
| 44377 | TGC ATC TGT AAC CTG GAG GA | Wild type Reverse | A | |||
| 44378 | TTG CAA AGC GTA CAA AGG TTC | Mutant Reverse | A | |||
| 44379 | Fluorophore-1 | TGT CTG AGC CCT TCG TTC TT | Quencher-1 | MUT Probe | ||
| 44380 | Fluorophore-2 | CTC GCA CAT GGC TTA GCT C | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44376 | 0.40 uM |
| 44377 | 0.40 uM |
| 44378 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.