For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:121780106+121780213 108bp CCTTAGGGGACAGGATGGTC TTTCAGGTCTTCACCCAATG
Mut= 106 bp
Wt= 108 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
ACAGGCCTCACAGCTGGAGGAGGAGAGGGGCAGCTCTCCCAAGCTGGCTGGGGGAAGTTTCAGAGGTTGCATAGTATCAAGTGTCCATCCACACAATGCAGCTGTTGGACAACTCTCCAAGGTGGGCTCTTTGTGCCTATAACCACTCGGTTAGgcagataaaaagggtggcatggaaggctatagattttaagggacttgggggggggctggcgggggggggaagccttgaacagttggtcaccaaagatccaaagccacagggggacctccctctcagagggggaaacttggctgatctgggccaggaggtgagcacaggaggtgagcacaggaggctcatggtggctgacccaaggatactgcctgcccacagtttgaccacttggactctgagtggctggggatgccgcctctcccttcacctcgctgcctcttcggcctgggggaggctctcaacgccatctacgtggtcggcggccgggaactcaaggacagcgaagacagcctggactcagtcctgtgctacgacaggctgtgagtgggcaggacggggccaccttaggggacaggatggtctggggcaggggccctagggtggtgctgggaccacagcagcaaccagGAGGCCTGCAAGGGTGCACAGCCATTGGGTGAAGACCTGAAAATAATCCTTGAGCAGAGGGGGAGATGGGCTGGCTCAAAGGCAGGAGAGCTCAGGGGAGGGGTTCCAGGAGTGTATTGAATGCAGTCTGCATGTGTCTTGTGGGTATGAGTGCAGAGA
This mutation is a 471 bp deletion beginning at Chromosome 9 position 121,779,701 bp and ending after 121,780,171 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44116 | CCT TAG GGG ACA GGA TGG TC | Wild type Forward | A | |||
| 44117 | TTT CAG GTC TTC ACC CAA TG | Common | A | |||
| 44118 | ACA CAA TGC AGC TGT TGG AC | Mutant Forward | A | |||
| 44119 | Fluorophore-1 | CTG GGA CCA CAG CAG CA | Quencher-1 | WT Probe | ||
| 44120 | Fluorophore-2 | CCA CTC GGT TAG GAG GCC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44116 | 0.40 uM |
| 44117 | 0.40 uM |
| 44118 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.