For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:116750971+116751094 124bp TCATATTTCTGCATCAGCATCC AAATAAAGCGAAAGCAGCAG
Mut= 112 bp
Wt= 124 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CAGTGCTCTTGCATTTTGAGCCATCTCAGCCCCCCCCCCCTTTTTTTTTTTGAGACTAGATCTCACAGTGTAGCCCAGGCTGGCCATGTACTCATATTTCTGCATCAGCATCCAGAATGCAAGATTTATTTTATCTAAGCTGTTACTAGACATCCTGGTatgttctgtgtgtggagaccttgctgtcacctacagctgctgctttcgctttatttaactttgtaggtgcgacacagagcttctggtcaggtgatggctctcaagatgaacacgctgagcagtaaccgagcaaacctgctgaaagagatgcagctcatgaatagactctcccaccccaacatcctcaggtaatgggttttccttccttccttccttccttccttccttccttccttccttccttccttccatccaggatcagtaagaggcatcactggatgcctgctgcagtagtactttatctcatggagtccatcttGCTGGGGTTGAGCTAGGCTCTAGGTCTTTTTCTCCCCATTACAACTTAATTTCCTGTAATTAACAATATTTAGTAAGGCAACTTCTCTCAAGTTGCTTTATTCTCATCAGAACATCAGTACTAGCCCATTAGAATAATTGTTTCCTACTGT
This mutation is a 319 bp deletion beginning at Chromosome 4 position 116,751,039 bp and ending after 116,751,357 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41023 | TCA TAT TTC TGC ATC AGC ATC C | Common | A | |||
| 41024 | AAA TAA AGC GAA AGC AGC AG | Wild type Reverse | A | |||
| 41025 | TTG TAA TGG GGA GAA AAA GAC C | Mutant Reverse | A | |||
| 41026 | Fluorophore-1 | TGT GGA GAC CTT GCT GTC AC | Quencher-1 | WT Probe | ||
| 41027 | Fluorophore-2 | CAT CCT GGT GCT GGG GT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41023 | 0.40 uM |
| 41024 | 0.40 uM |
| 41025 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.