For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:40015664+40015782 119bp CCCAGGTGATGAGATTAAAGG GGAAACTCAAGCTGCAAAGG
Mutant= 121 bp
Wild Type = 119 bp
Sequence
Wt Sequence: cccaggtgatgagattaaaggttgaaaGAagggggaaattagaagagtcctagggtgtcccctgccttgtctttgtaaagataactggttcttcgtgtgcctttgcagcttgagtttcc
Mutant Sequence: cccaggtgatgagattaaaggttgaaaGAtcagcttctcgactctcttagcagagagagtaagtagttaaggacactttgtgttcactctagtagaggaggctcagcctctggcatttcat
652 bp deletion beginning at Chromosome 9 positive strand position 40,208,107 bp, AAGGGGGAAATTAGAAGAGT, and ending after GACAATTCTGCCCACTTTAG at 40,208,758 bp (GRCm38/mm10)
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35230 | Fluorophore-1 | AGC TTC TCG ACT CTC TTA GCA GAG | Quencher-1 | MUT Probe | ||
| 35231 | CCC AGG TGA TGA GAT TAA AGG | Common | A | |||
| 35232 | ATG AAA TGC CAG AGG CTG AG | Mutant Reverse | A | |||
| 35233 | GGA AAC TCA AGC TGC AAA GG | Wild type Reverse | A | |||
| 35234 | Fluorophore-2 | AGT CCT AGG GTG TCC CCT G | Quencher-2 | Common |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35231 | 0.40 uM |
| 35232 | 0.40 uM |
| 35233 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.