For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:126397180-126397328 149bp AGAAGCCATGTCCCCAGA TCTCAAATGCACGCCTTC
Mutant= 152 bp
Wild Type = 149 bp
Sequence
Wt Sequence: agaagccatgtccccagagctagccttactgtgtaagaccgcttcttcccaggacttctggacaactgaggcgtctgagtcccctgcagaccagctgttggtatccttggcacatggctctgagccctccagaaggcgtgcatttgaga
Mut Sequence: CACTGTGTATCCTGGAAGTTTATTTATTACTAACTCGCAGATGTCTTTGccGTGGTCGCCATTGCTGTTGCCCCGGGCGACGCCGCCAGCTCGCTCCGCCAACCGGAAGCGGGAgcgagggtcacgtgaccggccgcgccctcgcgagacttgacttccggc
A 2611 bp deletion beginning at Chromosome 8 position 125,669,882 bp and ending after 125,672,492 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 67619 | GCC GGA AGT CAA GTC TCG | Mutant Reverse | A | |||
| 67620 | Fluorophore-1 | AGA TGT CTT TGC CGT GGT CGC CAT | Quencher-1 | MUT Probe | ||
| 67793 | CCT GGA AGT TTA TTT ATT ACT AAC TCG | Mutant Forward | A | |||
| 67794 | AGA AGC CAT GTC CCC AGA | Wild type Forward | A | |||
| 67795 | TCT CAA ATG CAC GCC TTC | Wild type Reverse | A | |||
| 67796 | Fluorophore-2 | ACA ACT GAG GCG TCT GAG TCC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 67619 | 0.40 uM |
| 67793 | 0.40 uM |
| 67794 | 0.40 uM |
| 67795 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.