For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:99978999-99979098 100bp AACGGATGGTTCTTGCAGAC TGGTGGGCACAGTTGGAA
Mutant= 109 bp
Wild Type = 100 bp
The common primer (primer 65204) anneals over the nucleotide sequence containing mouse genomic variation rs241097027.
Sequence
Wt Sequence aacggatggttcttgcagactcccagcctggctagtaggaacaccATGGCAGACAGCTGTTGCCCTGAAAACCCCACAGCTGTTCCAACTGTGCCCACCA
Mut Seq: aacggatggttcttgcagactcccagcctggctagtaggaacaccaTAtggacccacttcttgacaacctagctgtgagtgcagcctccccaaggccaaacttcatgat
A 1010 bp deletion beginning at Chromosome 11 position 99,978,042 bp and ending after 99,979,051 bp (GRCm38/mm10). This mutation deletes 1010 bp from ENSMUSE00000665201 (exon 1) and is predicted to generate a null allele.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65204 | AAC GGA TGG TTC TTG CAG AC | Common | A | |||
| 65205 | TGG TGG GCA CAG TTG GAA | Wild type Reverse | A | |||
| 65206 | ATC ATG AAG TTT GGC CTT GG | Mutant Reverse | A | |||
| 65207 | Fluorophore-1 | AGG AAC ACC ATA TGG ACC CAC | Quencher-1 | MUT Probe | ||
| 65208 | Fluorophore-2 | CAG ACA GCT GTT GCC CTG A | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65204 | 0.40 uM |
| 65205 | 0.40 uM |
| 65206 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.