For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:108451584-108451703 120bp GACAGGAAGCACGCTAGGAT TTGTGGGAACATGAGGGATT |
Mutant= 89 bp
Wild Type = 120 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase and insertion in <>:
gacaggaagcacgctaggatggagatttgggctctatcttcccttC<ACCT>Tcaagtccacctaagcctcagctttgtcttttgttttgt
This mutation is a 4121 bp deletion beginning at Chromosome 9 position 108,447,537 bp and ending after 108,451,657 bp, with a 4 bp insertion ACCT at the deletion site (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 62903 | GAC AGG AAG CAC GCT AGG AT | Common | A | |||
| 62904 | TTG TGG GAA CAT GAG GGA TT | Wild type Reverse | A | |||
| 62905 | ACA AAA CAA AAG ACA AAG CTG AGG | Mutant Reverse | A | |||
| 62906 | Fluorophore-1 | CTA TCT TCC CTT CCA CTC TAA ATT GA | Quencher-1 | WT Probe | ||
| 64892 | Fluorophore-2 | CTT CCC TTC ACC TTC AAG TCC A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 62903 | 0.40 uM |
| 62904 | 0.40 uM |
| 62905 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.