For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 93 bp
Wild Type = 93 bp
>chr19:38865790+38865882 93bp CATTTGCCAGGTGAGACCAT CCCATTTTGTAGCCCATGTT |
Sequence
Wt Sequence (deletions in lower case):
CCTGAGGGTCAGATATTCAGCTTGAAAAAAACAAATCTGTATGGACGATTCTACCaaaacatttgcataagtcagatagtctgaactgacttattccaagcagtgttggtataagtattagggataatttttatctaaaatattttaaatttgctttggaaataaatctgcttcttaacttattaattaatagttccctagttatggaaaacaattcatgtgaattttctgtgtttcagaaaccttttcccaaaaaggacaaaggaactcaaatcagttgtccatagtgctcctggctggaagttatttggtaaagtccctcccagagaaaatcttcagaaaacctccaaaattattcagcaggtaagtactaaaatgactgtgaagtttcccagggctcttacagcattgctcatttgccaggtgagaccatgagagtctcaggtggcagggtcaccccaaatttgtACATAGTGAAAACAAGCCAACATGGGCTACAAAATGGG
This mutation is a 413 bp deletion beginning at Chromosome 19 position 38,865,432 bp and ending after 38,865,844 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64766 | CAT TTG CCA GGT GAG ACC AT | Wild type Forward | A | |||
| 64767 | CCC ATT TTG TAG CCC ATG TT | Common | A | |||
| 64768 | CCT GAG GGT CAG ATA TTC AGC | Mutant Forward | A | |||
| 64769 | Fluorophore-1 | CTC AGG TGG CAG GGT CAC | Quencher-1 | WT Probe | ||
| 64770 | Fluorophore-2 | TGG ACG ATT CTA CCA CAT AGT GAA AAC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64766 | 0.40 uM |
| 64767 | 0.40 uM |
| 64768 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.