For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 103 bp
Wild Type = 117 bp
>chr7:141063532+141063648 117bp ATCTGCAATTCTTCCCAAGG TCCCTAATGAGAGCGAGGAG |
Sequence
Wt Sequence (deletions in lower case):
ATCTGCAATTCTTCCCAAGGCAAAGCCATTCTGAGAGgatcaccagatgggtgtgagtgtgtacagtttcacactagcctgagtatatatagccctgctcctcgctctcattagggactggagaaagctggtaaaagactcttgctttgtattgcccacccaaggtagggtctagaaggcacccaaatgatggaagcggaagtgttcagcagtccttcttgccccacccctccagctgacccccaacaacaaagataatggccttaaggagtctgagctctaacacgcctcatatgcgtctgcagatggggagaagctgaccggtgtgaccgatagccgcggagtccgagtgccatcgtccacacagaggtcggaggactcgagtgaaagtcatgaagaggagcaggcggtaaggagtggccgagaaaaacctagtcacaaggagccaccctctaggatgggtagatatgaccctgggttgtatgtgagtttcagcatcccagcctggatacagggtccgggtagtcactgagtggtatgcatctgttgtgcatccagtcagtggctacataactgtctgggcagatctgctgagggtatctgtgtgggagagtgcttaggtggtgagactggatgtgcaaaagggaaaccatgaagttctactctgctgtgtgtgcccagatggactgtgcagttgtgacacttcctgcctttagaactctgatatggctctttctttcctgcagcccgaggggcggggcccaaacatgctgtttcctggaggacctaggaagccacccccactgaacctcacccaccagacacccccatggcgggaagaggtaagctctgttgggctgggctggcctgggctgggaggaagggtggggcagactgtataacagctaatgtcccttctgaccctcagttcaaaggacaggtgaacctgcacgtgtttgaggactggtgtggaggtgctgtgggccacctgagacggaatctgcacttcccactctttcctcacgtgagtacctcaaggacgtacgggttggtaaggtgggcaaggcatgcaatgagctgtgagttagtagttattgcacaaccggcagactcgtactacggtgacaaagttagctgtgtcccctaagtggaagaactatggactccggatttttggcttcatccacccagccagagatggtgagtaggttgcatatggcaggggcaggatgtcttgaacagttcagcttcctgagcctctgtcctttggactaggagacatccagttctctgtggcttcggatgacaactctgagttctggctgagtttggatgagagcccagcagccgcccagcttgtagcctttgtgggcaaggtaagttctgccctcttgcctagctcctctatccacaccacatctgtcttctctggatctcctgcagcctcttggaaacacagactgtgtccaatgcccacagggagaatgtggtcattcctttgtcccccttgtgtcacccctagactggctccgagtggaccgcacctggagaattcaccaagttcagctcccaggtgtctaagccacgtcggtgagtaacttaagcgtgcatgcattcacacgtgtgtgcacatctatgttggcatatgagagggaggctgggtatcatgcttgcccatgtttcacaagcactgtcttcctgaggggtcatcccggagggatatgagattttgtcctaaccctctgggttcttattctgtttgatgagaagcaaccccaactccttatgtctacaggctcatggcctcccggagatactactttgaactgctccacaagcaagatgacaagggttcagaccatgtggaagtgggtgtgagtgtggcctgccctctgaagaagctccaaagaccacagctccccacccccacccacttcctctatcatcggacagtcactgcagggtggtccccagcccaaagggattaccagtctaggagataaagcagttatttgggaacatgggcgagggtcagGAGGGTATGCTATGCTTGCTGGATGCTCAGAGGGGCTGCACTGAAAAGTGGTCCTTCACCAGGAGA
This mutation is a 1998 bp deletion beginning at Chromosome 7 position 141,063,569 bp and ending after 141,065,566 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 63649 | ATC TGC AAT TCT TCC CAA GG | Common | A | |||
| 63650 | TCC CTA ATG AGA GCG AGG AG | Wild type Reverse | A | |||
| 63651 | TCT CCT GGT GAA GGA CCA CT | Mutant Reverse | A | |||
| 63652 | Fluorophore-1 | TTC TGA GAG GAT CAC CAG ATG G | Quencher-1 | WT Probe | ||
| 63653 | Fluorophore-2 | CCA TTC TGA GAG GAG GGT ATG CTA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 63649 | 0.40 uM |
| 63650 | 0.40 uM |
| 63651 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.