For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = T/T
Heterozygote = G/T
Wild type = G/G
>chr3:129215721+129215808 88bp GACTCATTTCACTAGCCAGCAG GATTTCTTCGCGAGTGGACA
The Mut Probe (primer 59338) anneals over the nucleotide sequence containing mouse genomic variation rs216631188.
Sequence
GAGGACTCATTTCACTAGCCAGCAGCTGCAGGAGCTGGAAGCCACTTTCCAGAGAAACC[g/t]CTACCCAGACATGTCCACTCGCGAAGAAATCGCCGTGTGGACCAACCTTACGGAAGCCCG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 59335 | GAC TCA TTT CAC TAG CCA GCA G | Forward | A | |||
| 59336 | GAT TTC TTC GCG AGT GGA CA | Reverse | A | |||
| 59337 | Fluorophore-1 | CAG AGA AAC CGC TAC CCA GAC | Quencher-1 | WT Probe | ||
| 59338 | Fluorophore-2 | CCA GAG AAA CCT CTA CCC AGA CA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 59335 | 0.40 uM |
| 59336 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.