For in-depth product & services help, ask our
Technical Information Scientists
This assay cannot distinguish hemi from hom
Tg= 104 bp
IPC = 74 bp
Tg Sequence: AATGGGGGAAATGAACTGCTTTAGTAACATCATCTGTTTTTTCTGTGAGCAGCGTAGCTTGACAGCCATTGGTGAACTCGTGCCCTGTGCTTCCCTGTCCAGAT
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52355 | AAT GGG GGA AAT GAA CTG CT | Transgene Forward | A | |||
| 52356 | ATC TGG ACA GGG AAG CAC AG | Transgene Reverse | A | |||
| 52357 | Fluorophore-1 | CAG CGT AGC TTG ACA GCC A | Quencher-1 | Tg Probe | ||
| oIMR1544 | CAC GTG GGC TCC AGC ATT | Internal Positive Control Forward | A | |||
| oIMR3580 | TCA CCA GTC ATT TCT GCC TTT G | Internal Positive Control Reverse | A | |||
| TmoIMR0105 | Fluorophore-2 | CCA ATG GTC GGG CAC TGC TCA A | Quencher-2 | IC Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52355 | 0.40 uM |
| 52356 | 0.40 uM |
| oIMR1544 | 0.40 uM |
| oIMR3580 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.