For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:50378353+50378449 97bp GAGAGGGCTTCGTGGTGAAG GACAACTCCCGCCTCAACTC
Mut= 97 bp
Wt= 97 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence:
ATGATGCTGGGAGCAGAAGGCGGAGAGGGCTTCGTGGTGAAGGTCCGGGGCTTgccctggtcctgctccGCGGATGAAGTGCAGCGCTTTTTTTCTGgtgagttgaggcgggagttgtcagtggggcccgcggctgg
Mutant Sequence:
CTGGGAGCAGAAGGCGGAGAGGGCTTCGTGGTGAAGGTCCGGGGCTTGCGGATGAAGTGCAGCGCTTTTTTTCTGgtgagttgaggcgggagttgtcagtggggcccgcggctgg
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52221 | GAG AGG GCT TCG TGG TGA AG | Forward | A | |||
| 52222 | GAC AAC TCC CGC CTC AAC TC | Reverse | A | |||
| 52223 | Fluorophore-1 | CTT GCC CTG GTC CTG CTC | Quencher-1 | WT Probe | ||
| 52224 | Fluorophore-2 | CGG GGC TTG CGG ATG A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52221 | 0.40 uM |
| 52222 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.