For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = A, G, C, C
Wild type = G, A, T, T
>chr14:27966492+27966587 96bp GCTGGAGAGATCCGTGATATG AAAGGGGTTGTATCAGCTACTCAC
Sequence
AGAGAAGGGGACCCTAGCTGGAGAGATCCGTGATATGAAAGATATGTTAGAAGTAAA(g/a)GAAAGGAAAATCA(a/g)TGT(t/c)CT(t/c)CAGAAAAAAGTGAGTAGCTGATACAACCCCTTTAACCTG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50286 | GCT GGA GAG ATC CGT GAT ATG | Forward | A | |||
| 50287 | AAA GGG GTT GTA TCA GCT ACT CAC | Reverse | A | |||
| 50288 | Fluorophore-1 | AGG AAA GGA AAA TCA ATG TTC TTC A | Quencher-1 | WT Probe | ||
| 50289 | Fluorophore-2 | AAG AAA GGA AAA TCA GTG TCC TCC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50286 | 0.40 uM |
| 50287 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.