For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 97 bp
Wild Type = 95 bp
>chrX:98462848-98462942 95bp AGTTTCTCATGGGATGCATTG ACAAGGCAAAAGAATGATGG
X-linked
Sequence
Wt Sequence (deletions in lower case):
AAGGGGGAGGGTAGCACGGGAAGAAGAAAAGGGAGGTTAGCTGGGAGAGACTGCTTGAGGACCCAATCAAGTGGGTAGCCAGCTCTTCAGGAACCCTACCAGTTTCTCATGGGATGCATTGTCAGTTCAGACcagatgaggctagctaatgggcatatgcatgcccatgtttggcccatcattcttttgccttgtaacccttctctaggtacaaggtatctgataataatacattccaggagtgcagtcactatttgttctccaaagagattacttctggctgtcagatacaaaaagaagatatccagctctaccagacatttgttgtccagctccaggacccccagaaaccccagaggcgagctgtacagaagctaaacctacagaatcttggtaatcgggaaagaagtagccaagagagcagggagcttaaagacactggagtttatagattgttggccatgggCAGAAAAGAGAAGATAGGGGGGTTGGGATGGGGAAGGGAGGAGGGATAAGGGGAATTACCTCCAAGATCCTGACTTGTCTAGGCCAGGGCAATGACCACACACATACATATCTCCAGTGATCCCACGGGCTCCAGAAAATCT
334 bp deletion
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48027 | ACA AGG CAA AAG AAT GAT GG | Wild type Reverse | A | |||
| 48028 | AGT TTC TCA TGG GAT GCA TTG | Common | A | |||
| 48029 | Fluorophore-1 | AGA TGA GGC TAG CTA ATG GGC | Quencher-1 | WT Probe | ||
| 48030 | TTG GAG GTA ATT CCC CTT ATC C | Mutant Reverse | A | |||
| 48031 | Fluorophore-2 | TCA GTT CAG ACC AGA AAA GAG AAG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48027 | 0.40 uM |
| 48028 | 0.40 uM |
| 48030 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.