Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr13:24422533+24422630 98bp GCCATCACACTTCATCAGCA CTTCCAGTTGTGCTTTGTGC
Mutant= 115 bp
Wild Type = 98 bp
Wt Sequence: gccatcacacttcatcagcactaatttttttcactgtgtagtacaactgactctcatttccccccagGTCCGTTAAATGCACAAAGCACAACTggaag
Mutant Sequence: gccatcacacttcatcagcactaatttttttcactgtgtagtacaactgactctcatttccccccaGGAAGTTAGACGTGAGCACCATGAAATATATCAACCCTCCAGGGAGCTT
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 14414 | CTT CCA GTT GTG CTT TGT GC | Wild type Reverse | A | |||
| 43144 | GCC ATC ACA CTT CAT CAG CA | Common | A | |||
| 43145 | AAG CTC CCT GGA GGG TTG A | Mutant Reverse | A | |||
| 43146 | Fluorophore-1 | TTT CCC CCC AGG TCC GT | Quencher-1 | WT Probe | ||
| 43147 | Fluorophore-2 | CCC CCA GGA AGT TAG ACG T | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 14414 | 0.40 uM |
| 43144 | 0.40 uM |
| 43145 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.