For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 105 bp
Wild Type = 101 bp
>chr19:24351801-24351901 101bp TCAGTCCCTCAGCACTGTACC CTTCGTCTACTCTGATCCAGCA
Sequence
Wt Sequence:
Mutant Sequence:
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42872 | TCA GTC CCT CAG CAC TGT ACC | Wild type Forward | A | |||
| 42873 | CTT CGT CTA CTC TGA TCC AGC A | Wild type Reverse | A | |||
| 42874 | TGC CTT CCA CTT CCT CTC TC | Mutant Forward | A | |||
| 42875 | CAT TAT ACG AAG TTA TGG GGG ATG | Mutant Reverse | A | |||
| 42876 | Fluorophore-1 | ATG CTG TAA TTG GCT ACT CTC GAG TAT AGG | Quencher-1 | WT Probe | ||
| 42877 | Fluorophore-2 | CCC TGG GAA CAA CCT TGA GTG AC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42872 | 0.40 uM |
| 42873 | 0.40 uM |
| 42874 | 0.40 uM |
| 42875 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.