For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant =A/A
Heterozygote = T/A
Wild type = T/T
>chr5:30696961-30697067 107bp TCGACTTCCATGTCTCTCCTG TCCTGCGTTAGTCAGTGTGG
Sequence
SEQ
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40489 | Fluorophore-1 | TCG ACT TCC ATG TCT CTC CTG | Quencher-1 | Forward | A | |
| 40490 | Fluorophore-2 | TCC TGC GTT AGT CAG TGT GG | Quencher-2 | Reverse | A | |
| 40491 | Fluorophore-3 | TCA TCA AGA TCT CGG TGA GTG G | Quencher-3 | WT Probe | ||
| 40492 | Fluorophore-4 | TCA TCA AGA ACT CGG TGA GTG G | Quencher-4 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40489 | 0.40 uM |
| 40490 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.