For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 148 bp
Wild Type = 98 bp
>chr19:24338921-24339018 98bp TGTGCTGCTAAGCTGTGTCC AACAGACAATGAACCCTGAGAG
Sequence
Wt Sequence:acctacacaagatacttcccatctcttccctctaccctgccttcccaccacacctcagtctcctcatggttttgtgatgctggagatctaacaatgcggtcaccacgctgggaccgctcaagcactgtgctgctaagctgtgtccccactcttctagtgtggggttcttcgaaagttcccTCGAGTGTTCTcagtggtgaactctcagggttcattgtctgttactgtgtcc
Mutant Sequence: GTGTCAGTTTCATAGCCTGAAGAACGAGATCAGCAGCCTCTGTTCCACATACACTTCATTCTCAGTATTGTTTTGCCAAGTTCTAATTCCATCAGAAGctATAACTTCGTATAATGTATGCTATACGAAGTTATctagaattagatctcccggggggtccgtgctcggtgccgatctCTCGAGTGTTCTCAGTGGTGAACTctcAGGGTTCATTGTCTGTTACTGTGTCCACTGTTCTCCAGGCCATGAGGAGCTAGAACGtgagacaagggtcttatacatctggaataacaaatcatggccaacaccagct
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 27228 | TGC CAA GTT CTA ATT CCA TCA G | Mutant Forward | A | |||
| 36828 | AAC AGA CAA TGA ACC CTG AGA G | Common | A | |||
| 36830 | Fluorophore-1 | CGT GCT CGG TGC CGA TCT | Quencher-1 | MUT Probe | ||
| 37924 | Fluorophore-2 | TCT TCT AGT GTG GGG TTC TTC GAA AGT | Quencher-2 | WT Probe | ||
| 38230 | TGT GCT GCT AAG CTG TGT CC | Wild type Forward | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 27228 | 0.40 uM |
| 36828 | 0.40 uM |
| 38230 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.