For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 105 bp
Wild Type = 132 bp
>chr11:69398179+69398310 132bp CAGCCTGCCTAGCTTCCTC AGAAAATGTTGGCTGGGAAAG
Sequence
Wt Sequence: tcaatagcagcctgcctagcttcctcaggatcaaatgagatgagcccctgagaagagcaaggcccgctgggcctggaaggccagccctggttgtactcaaacCTCTCGAgtctattgcctttcccagccaacattttcttacacatccagcctctgtggatactgtgaccctcctgatctggttcttgtgaaaagtttcatattggcaact
Mutant Sequence: agctagccaccatGGCTTGAGTAAGTCTGCAGGTCGAGGGACCTAATAACTTCGTATAGCATACATTATACGAAGTTATgtcGAGTCTATTGCCTTTCCCAGCCAACATTTTCTTACACATCCAGCC
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 25929 | CCA TGG CTT GAG TAA GTC TGC A | Mutant Forward | A | |||
| 35283 | AGA AAA TGT TGG CTG GGA AAG | Common | A | |||
| 35284 | CAG CCT GCC TAG CTT CCT C | Wild type Forward | A | |||
| 35285 | Fluorophore-1 | TCG AGG GAC CTA ATA ACT TCG TAT AGC A | Quencher-1 | MUT Probe | ||
| 35286 | Fluorophore-2 | CCT GGT TGT ACT CAA ACC TCT CGA GTC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 25929 | 0.40 uM |
| 35283 | 0.40 uM |
| 35284 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.