Protocol 22232 - Human IAPP protocol 2

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

atgggcatcctgaagctgcaagtatttctcattgtgctctctgttgcattgaaccatctgaaagctacacccattgaaagtcatca

ggtggaaaagcggaaatgcaacactgccacatgtgcaacgcagcgcctggcaaattttttagttcattccagcaacaactt

tggtgccattctctcatctaccaacgtgggatccaatacatatggcaagaggaatgcagtagaggttttaaagagagagcca

ctgaattacttgcccctttag

JAX Protocol

Protocol Primers

Primer	5' Label	Sequence 5' → 3'	3' Label	Primer Type	Reaction
12855		CAG CGC CTG GCA AAT TTT		Transgene Forward	A
12856		GCA TTC CTC TTG CCA TAT GTA TTG		Transgene Reverse	A
12857	Fluorophore-1	CCA CGT TGG TAG ATG AGA GAA TGG CAC	Quencher-1	Tg Probe
oIMR1544		CAC GTG GGC TCC AGC ATT		Internal Positive Control Forward	A
oIMR3580		TCA CCA GTC ATT TCT GCC TTT G		Internal Positive Control Reverse	A
TmoIMR0105	Fluorophore-2	CCA ATG GTC GGG CAC TGC TCA A	Quencher-2	IC Probe

Reaction A

Component	Final Concentration
ddH2O
Kapa Probe Fast QPCR	1.00 X
12855	0.40 uM
12856	0.40 uM
oIMR1544	0.40 uM
oIMR3580	0.40 uM
Tg Probe	0.15 uM
IC Probe	0.15 uM
DNA

Cycling

Step	Temp °C	Time	Note
1	95.0	--
2	95.0	--
3	60.0	--	repeat steps 2-3 for 40 cycles

JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.