For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 102 bp
Wild Type = 145 bp
Sequence
Wt Sequence:gcctcctggcttctgaggaccgccctgggcctgggagaatcccttccccctcttccctcgtgatctgcaactccagtctTTCTagaagatgggcgggagtcttctgggcaggcttaaaggctaacctggtgtgtgggcgttgtcctgcagg
ggaattgaacaggtgtaaaattggagggacaagacttcccacagattttcggttttgtcgggaagttt
Mutant Sequence: TGTATCTTATCATGTCTGGATCCCCATCAAGCTGATCCGGAACCCTTAATATAACTTCGTATAATGTATGCTATACGAAGTTATTAGGTCCCTCGACCTGCAGCCCAAGCTAGATCGAATTC
GGCCGGCCGCGATCGCCTAGGGATGCATgaattcgccaccatgtacccatacgatgttccagattacgctatgACCTTGCACAATAacagtacaacctcgcctttgtttccaaacatcagctcctcctggatacacagcccctcc
gatgcagggctgcccccgggaaccgtcactcatttcggcagctacaatgtttctcgagcagctggcaatttctcctctccagacggtaccaccg
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 21310 | Fluorophore-1 | TAA CCT GGT GTG TGG GCG TTG T | Quencher-1 | WT Probe | ||
| 32843 | TCG CCT AGG GAT GCA TGA | Mutant Forward | A | |||
| 32845 | Fluorophore-2 | TCG CCA CCA TGT ACC CAT ACG | Quencher-2 | MUT Probe | ||
| 32851 | GAC TGA TTG CCC GAG CTG | Mutant Reverse | A | |||
| oIMR3621 | CGT GAT CTG CAA CTC CAG TC | Wild type Forward | A | |||
| oIMR9021 | CCG AAA ATC TGT GGG AAG TC | Wild type Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 32843 | 0.40 uM |
| 32851 | 0.40 uM |
| oIMR3621 | 0.40 uM |
| oIMR9021 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.