Genotyping Protocols Database
Stock No: 010908
Protocol 22106: Probe Assay - Gt(rosa)26sor<Tm1Sor> Probe
Version 3.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mut= 195 bp

Wt= 193 bp

Sequence

Wt Sequence:

 

CTGGCTTCTGAGGACCGCCCTGGGCCTGGGAGAATCCCTTCCCCCTCTTCCCTCGTGATCTGCAACTCCAGtctttctagaaGATGGGCGGG

AGTCTTCTGGGCAGGCTTAAAGGCTAACCTGGTGTGTGGGCGTTGTCCTGCAGGGGAATTGAACAGGTGTAAAATTGGAGGGACAAGACTTCCCACAGATT

Mutant Sequence:

CTGGCTTCTGAGGACCGCCCTGGGCCTGGGAGAATCCCTTCCCCCTCTTCCCTCGTGATCTGCAACTCCAGTCTTTCTAGtgGATCCCCCg

ggcTGCAGATctgTAGGGCGCAGTAGTCCAGGGTTTCCTTGATGATGTCATACTTATCCTGTCCCTTTTTTTTCCACAGCTCGCGGTTGAGGACAAACTCTTCG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
21306 CTG GCT TCT GAG GAC CG Common A Gt(ROSA)26Sor
21307 CGA AGA GTT TGT CCT CAA CCG Mutant Reverse A SA site
21308 Fluorophore-1 ACC CTG GAC TAC TGC GCC C Quencher-1 MUT Probe SA site
21309 AAT CTG TGG GAA GTC TTG TCC Wild type Reverse A Gt(ROSA)26Sor
21310 Fluorophore-2 TAA CCT GGT GTG TGG GCG TTG T Quencher-2 WT Probe Gt(ROSA)26Sor

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
21306 0.40 uM
21307 0.40 uM
21309 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
002955 C.129S7-Gt(ROSA)26Sor/J
003309 B6;129S4-Gt(ROSA)26Sortm1Sor/J
003310 129S-Gt(ROSA)26Sortm1Sor/J
003474 B6.129S4-Gt(ROSA)26Sortm1Sor/J
006911 B6;129-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm2(tetO-Pou5f1)Jae/J
006954 FVB-Tg(Ddx4-cre)1Dcas/J
006965 B6.Cg-Gt(ROSA)26Sortm1(rtTA*M2)Jae/J
007708 B6.129-Gt(ROSA)26Sortm1(HD*103Q)Xwy/J
007743 B6.129S4-Gt(ROSA)26Sortm3(phiC31*)Sor/J
007900 C57BL/6-Gt(ROSA)26Sortm1(HBEGF)Awai/J
008040 CBy.B6-Gt(ROSA)26Sortm1(HBEGF)Awai/J
008159 STOCK Gt(ROSA)26Sortm1(Notch1)Dam/J
008600 STOCK Gt(ROSA)26Sortm1(tTA)Roos/J
008603 C.129P2(B6)-Gt(ROSA)26Sortm1(tTA)Roos/J
008708 B6.129P2(Cg)-Hprttm8(Ple151-EGFP)Ems/Mmjax
008709 B6.129P2(129S4)-Hprttm9(Ple178-EGFP/cre)Ems/Mmjax
008847 STOCK Tg(Msx2-cre/ERT)27Alj/J
008852 STOCK Tg(En2-cre)22Alj/J
008883 B6;129-Gt(ROSA)26Sortm1(SNCA*A53T)Djmo/TmdJ
008886 B6;129-Gt(ROSA)26Sortm3(SNCA*E46K)Djmo/TmdJ
008889 B6;129-Gt(ROSA)26Sortm2(SNCA*119)Djmo/TmdJ
009114 B6.129P2(129S4)-Hprttm14(Ple103-EGFP/cre)Ems/Mmjax
009115 B6.129P2(Cg)-Hprttm15(Ple111-EGFP)Ems/Mmjax
009118 B6.129P2(Cg)-Hprttm18(Ple90-EGFP)Ems/Mmjax
009348 B6.129P2(Cg)-Hprttm17(Ple48-lacZ)Ems/Mmjax
009349 STOCK Hprttm31(Ple67-EGFP)Ems/Mmjax
009573 B6(129S4)-Et(cre/ERT2)4Rdav/J
009574 B6(129S4)-Et(cre/ERT2)21Rdav/J
009575 B6(129S4)-Et(cre/ERT2)119Rdav/J
009576 B6;129S4-Et(cre/ERT2)278Rdav/J
009577 B6(129S4)-Et(cre/ERT2)296Rdav/J
009578 B6(129S4)-Et(cre/ERT2)398Rdav/J
009579 B6(129S4)-Et(cre/ERT2)837Rdav/J
009580 B6(129S4)-Et(cre/ERT2)1382Rdav/J
009581 B6(129S4)-Et(cre/ERT2)1642Rdav/J
009582 B6(129S4)-Et(cre/ERT2)1645Rdav/J
009583 B6(129S4)-Et(cre/ERT2)1957Rdav/J
009585 B6(129S4)-Et(cre/ERT2)2047Rdav/J
009586 B6(129S4)-Et(icre)754Rdav/J
009587 B6(129S4)-Et(icre)1402Rdav/J
009588 B6(129S4)-Et(icre)1470Rdav/J
009589 B6(129S4)-Et(icre)1555Rdav/J
009594 STOCK Hprttm32(Ple112-EGFP)Ems/Mmjax
009596 B6.129P2(Cg)-Hprttm33(Ple183-EGFP)Ems/Mmjax
009606 STOCK Tg(Six2-EGFP/cre)1Amc/J
009673 B6.129S6(C)-Gt(ROSA)26Sortm3(HIF1A*)Kael/J
009674 STOCK Gt(ROSA)26Sortm4(HIF2A*)Kael/J
010671 B6.129S4-Pkd1tm2Ggg/J
010688 B6(129S4)-Et(cre/ERT2)6691Rdav/J
010689 B6(129S4)-Et(cre/ERT2)6959Rdav/J
010690 B6(129S4)-Et(cre/ERT2)7089Rdav/J
010691 B6(129S4)-Et(cre/ERT2)7149Rdav/J
010692 B6(129S4)-Et(cre/ERT2)7381Rdav/J
010693 B6(129S4)-Et(cre/ERT2)8120Rdav/J
010694 B6(129S4)-Et(cre/ERT2)8131Rdav/J
010695 B6(129S4)-Et(cre/ERT2)9699Rdav/J
010696 B6(129S4)-Et(icre/ERT2)10596Rdav/J
010697 B6(129S4)-Et(icre/ERT2)10727Rdav/J
010702 STOCK Gad2tm1(cre/ERT2)Zjh/J
010705 B6(Cg)-Dlx5tm1(cre/ERT2)Zjh/J
010707 STOCK Hprttm37(lacZ)Ems/Mmjax
010709 B6.129P2(Cg)-Hprttm44(Ple49-lacZ)Ems/Mmjax
010776 B6(Cg)-Lhx6tm1(cre/ERT2)Zjh/J
010777 B6(Cg)-Pvalbtm1(cre/ERT2)Zjh/J
010908 STOCK Viptm1(cre)Zjh/J
010910 STOCK Corttm1(cre)Zjh/J
010911 STOCK Wt1tm1(EGFP/cre)Wtp/J
011001 B6;129S4-Col1a1tm1(tetO-Pou5f1,-Klf4,-Sox2,-Myc)Hoch/J
011008 B6.129P2(Cg)-Gt(ROSA)26Sortm1(tTA)Roos/J
011011 STOCK Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm4(tetO-Pou5f1,-Sox2,-Klf4,-Myc)Jae/J
011013 STOCK Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm5(tetO-Pou5f1,-Klf4,-Myc)Jae/J
011034 FVB(Cg)-Tg(Ghrhr-cre)3242Lsk/J
012335 STOCK Hprttm50(Ple55-lacZ)Ems/Mmjax
012353 STOCK Hprttm65(Ple53-lacZ)Ems/Mmjax
012373 B6;129S-Hoxb1tm1(cre)Og/J
012464 B6;129S4-Foxd1tm2(GFP/cre/ERT2)Amc/J
012580 B6.129P2(Cg)-Hprttm59(Ple123-lacZ)Ems/Mmjax
012581 B6.129P2(Cg)-Hprttm62(Ple153-lacZ)Ems/Mmjax
012583 B6.129P2(Cg)-Hprttm68(Ple127-lacZ)Ems/Mmjax
012584 STOCK Hprttm69(Ple134-lacZ)Ems/Mmjax
012687 B6(129S4)-Tg(SYN1-icre/mRFP1)9934Rdav/J
012688 B6(129S4)-Et(cre/ERT2)13866Rdav/J
012690 B6(129S4)-Et(icre/ERT2)14208Rdav/J
012691 STOCK Et(icre/ERT2)14374Rdav/J
012692 STOCK Et(icre/ERT2)14602Rdav/J
012693 STOCK Et(icre/ERT2)14624Rdav/J
012704 B6(Cg)-Crhtm1(cre)Zjh/J
012930 B6.129S4-Gt(ROSA)26Sortm2(FLP*)Sor/J
013730 B6(Cg)-Calb2tm2.1(cre/ERT2)Zjh/J
014158 STOCK Tg(Pax4-cre)1Dam/J
014536 B6.Cg-Hprttm75(Ple143-lacZ)Ems/Mmjax
014581 STOCK Trpm8tm1Apat/J
014588 B6.Cg-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm6(tetO-MSI2)Jae/J
014592 B6;129S4-Col1a1tm1(tetO-mCherry)Eggn/J
014602 B6.Cg-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm1(tetO-mCherry)Eggn/J
016097 C57BL/6-Tg(Car1-cre)5Flt/J
016117 STOCK Nogtm1.1Rmh/J
016262 B6;129-Gt(ROSA)26Sortm1(Foxo1/GFP)Jke/J
016603 NOD.B6-Gt(ROSA)26Sortm1(HBEGF)Awai/DvsJ
016933 B6.129P2(Cg)-Cdh1tm1Cle/J
016977 FVB.129S6-Gt(ROSA)26Sortm1(Pik3ca*H1047R)Egan/J
017962 B6;129-Gt(ROSA)26Sortm1(RAC1*)Jkis/J
017983 B6.Cg-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm9(tetO-Dnmt3b_i1)Jae/J
019013 B6N.129S6(Cg)-Gt(ROSA)26Sortm2(EGFP/cre)Alj/J
019101 B6N.129S4(B6)-Gt(ROSA)26Sortm1Sor/CjDswJ
021025 B6;129-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm1(tetO-cre)Haho/J
021039 B6;129-Gt(ROSA)26Sortm5(CAG-Sun1/sfGFP)Nat/J
021070 B6.Cg-Tg(Thy1-PA-GFP)6Rmpl/J
021071 B6.Cg-Gt(ROSA)26Sortm1(CAG-PA-GFP)Rmpl/J
021429 B6;129-Gt(ROSA)26Sortm4(CAG-EGFP*)Nat/J
022516 B6;129S-Gt(ROSA)26Sortm1(Cdkn1c)Jfpa/J
022793 STOCK Gt(ROSA)26Sortm1(LRRK2*R1441C)Djmo/J
023749 B6.Cg-Gt(ROSA)26Sortm1(rtTA*M2)Jae Tg(tetO-Pou5f1,-Sox2,-Klf4,-Myc)1Srn/J
023843 B6;129-Gt(ROSA)26Sortm6(Fzd6)Nat/J
023965 STOCK Tg(Krt17-EGFP)#Cou/J
025977 STOCK Gt(ROSA)26Sortm1.1(birA)Mejr Zfpm2tm1.1Wtp /Mmjax
025978 STOCK Gt(ROSA)26Sortm1.1(birA)Mejr Nkx2-5tm1.1Wtp/Mmjax
025983 STOCK Gt(ROSA)26Sortm1.1(birA)Mejr Mef2ctm1.1Wtp/Mmjax
026293 B6.Cg-Gt(ROSA)26Sortm1(LRRK2*R1441C)Djmo/J
026863 D2.129S4(B6)-Gt(ROSA)26Sortm1Sor/SjJ
029415 B6;129S4-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm1(tetO-cas9)Sho/J
029784 B6.Cg-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm1(tetO-U2AF1*S34F)Mjwa/J
032087 B6.129S(Cg)-Gt(ROSA)26Sortm1(DTA)Jpmb/J
123 strains use this protocol