Stock No: 002703
Protocol 37103: Separated PCR Assay - A<w-J> A<y> A<w> Alternate2
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

HET = 268 bp and 763 or 162 bp
MUT A = 763 bp and 162 bp in agouti (A) allele

WT nonagouti (a) = 268 bp

>chr2:155017745+155018012 268bp AGTCCCACAGAGACGAGACC GAGGGGACTATAATTCAGCTTTTAC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
50528 AGT CCC ACA GAG ACG AGA CC Wild type Forward A
50529 GAG GGG ACT ATA ATT CAG CTT TTA C Wild type Reverse A
oIMR7876 GGC CAC ACT TAG GGA GTT CA Mutant Forward B
oIMR7932 GGT TGG CCA CCA TGT CTA GT Mutant Reverse B

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
50528 0.50 uM
50529 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Reaction B

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
oIMR7876 0.50 uM
oIMR7932 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
000202 AEJ/Gn-bd/J
000199 AEJ/GnLeJ
000427 B10.CE-H13b Aw/(30NX)SnJ
000420 B10.LP-H13b Aw/Sn
000593 B6 x B6CBCa Aw-J/A-Grid2Lc T(2;6)7Ca MitfMi-wh/J
000502 B6 x B6CBCa Aw-J/A-Myo5aflr Gnb5flr/J
000599 B6 x B6CBCa Aw-J/A-T(5;13)264Ca KitW-v/J
002016 B6(Cg)-Aw-J EdaTa-6J Chr YB6-Sxr/EiJ
000600 B6-Gpi1b x B6CBCa Aw-J/A-T(7;15)9H Gpi1a/J
000552 B6.Cg-Aw-J EdaTa-6J Sxr
001730 B6.Cg-Aw-J EdaTa-6J Sxrb Hya-/J
000841 B6.Cg-Aw-J EdaTa-By/J
005505 B6.Cg-Ay Slc7a11sut/LmLlp
000021 B6.Cg-Ay/J
004200 B6;CBACa Aw-J/A-Npr2cn-2J/GrsrJ
100409 B6129PF1/J-Aw-J/Aw
000505 B6C3 Aw-J/A-Bloc1s5mu/J
000314 B6CBACa Aw-J/A-EdaTa/J-XO
000288 B6CBACa Aw-J/A-Tgm3we a Mafbkr/J
000501 B6CBACa Aw-J/A-Aifm1Hq/J
001046 B6CBACa Aw-J/A-Grid2Lc/J
000500 B6CBACa Aw-J/A-Gs/J
002703 B6CBACa Aw-J/A-Hydinhy3/J
000247 B6CBACa Aw-J/A-Kcnj6wv/J
000287 B6CBACa Aw-J/A-Plp1jp EdaTa/J
000515 B6CBACa Aw-J/A-SfnEr/J
000242 B6CBACa Aw-J/A-spc/J
001201 B6CBACaF1/J-Aw-J/A
002343 B6EiC3Sn a/A-Otcspf/J
000638 C3FeB6 A/Aw-J-Sptbn4qv-J/J
000200 C3FeB6 A/Aw-J-Ankank/J
001203 C3FeB6F1/J A/Aw-J
000664 C57BL/6J
000338 C57BL/6J Aw-J-EdaTa-6J/J
000569 C57BL/6J-Aw-J-EdaTa +/+ ArTfm/J
000051 C57BL/6J-Aw-J/J
002468 KK.Cg-Ay/J
000064 STOCK a Tyrp1b Pmelsi/J
001432 STOCK a/a Tyrp1b Ndc1sks/Tyrp1b +/J
001427 STOCK Aw us/J
001752 STOCK T(7;15)9H/J
41 strains use this protocol