For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = ~550 bp
Heterozygote = 318 bp and ~550 bp
Wild type = 318 bp
>chr5:108819374+108819691 318bp CATGTCCTACAGCCCCTCTC ACCATTTGCAAGGAAAGCAC
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 36758 | CAT GTC CTA CAG CCC CTC TC | Common | A | |||
| 36759 | ACC ATT TGC AAG GAA AGC AC | Wild type Reverse | A | |||
| oIMR2093 | AAG CTA GCT GCA GTA ACG CCA TTT | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 36758 | 0.50 uM |
| 36759 | 0.50 uM |
| oIMR2093 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 037206 | B6.129-Optntm1.1Htse/J |
| 004202 | B6.C3 Pde6brd1 Hps4le/+ +-Lmx1adr-8J/J |
| 000002 | B6.C3-Pde6brd1 Hps4le/J |
| 015850 | B6.Cg-Pde6b+ Tg(Rho-icre)1Ck/Boc |
| 006576 | B6.FVB-Tg(GNAT2-Dta)98Wwk/J |
| 004462 | B6;C3-Tg(APPswe,PSEN1dE9)85Dbo/Mmjax |
| 028590 | B6C3-Tg(tetO/Prnp-TARDBP*)2Vle/J |
| 000235 | B6C3Fe a/a-Relnrl/J |
| 001924 | B6EiC3Sn a/A-Ts(1716)65Dn/J |
| 004850 | B6EiC3Sn-Rb(12.Ts171665Dn)2Cje/CjeDnJ |
| 001957 | C3A Pde6brd1.O20/A-Prph2Rd2/J |
| 001912 | C3A.BLiA-Pde6b+/J |
| 001979 | C3A.Cg-Pde6b+ Prph2Rd2/J |
| 024703 | C3A.Cg-Pde6b+Tg(Thy1-CFP)23Jrs/SjJ |
| 003648 | C3Sn.BLiA-Pde6b+/DnJ |
| 000654 | CBA/CaJ |
| 000656 | CBA/J |
| 034245 | FVB(129P2)-Pde6b+ Gtf2iem2Jdd Gtf2ird1em2Jdd Tyrc-ch/Mmjax |
| 034672 | FVB(129P2)-Pde6b+ Gtf2ird1em3Jdd Tyrc-ch/Mmjax |
| 004624 | FVB.129P2-Pde6b+ Tyrc-ch Fmr1tm1Cgr/J |
| 004828 | FVB.129P2-Pde6b+ Tyrc-ch/AntJ |
| 022880 | FVB.Cg-Pde6b+ Lrrk1tm1.1Mjff Tyrc-ch/J |
| 038293 | FVB.Cg-Pde6b+ Tyrc-ch Ccdc198em1Iad/J |
| 003342 | STOCK Hbatm1Paz Hbbtm1Tow Tg(HBA-HBBs)41Paz/J |
| 013169 | STOCK Nphp1tm1Jgg/J |
| 005441 | STOCK Tg(CAG-DsRed*MST)1Nagy/J |
| 004808 | STOCK Tg(MAPT)8cPdav Mapttm1(EGFP)Klt/J |
| 010815 | STOCK Tg(mI56i-flpe)39Fsh/J |
| 28 strains use this protocol | |