Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 79 bp
Wild Type = 94 bp
>chr5:108819412+108819505 94bp TGTGGCCTCAAAGATACATCC GGATCAATACAAACCTGCACAAC
Wt Sequence: ctacccatgtcctacagcccctctccaaggtttataGTcactctgtggcctcaaagatacatcctTGgtggcacatcatgtctactactgttatgatgattctgtgacctgcaggttgtgcaggtttgtattgatcccagactgagggaaaaggagtaaccgtcaaagtcagcaaaatccatatttccaccagtggcatcaggacactctgcatcgccaaggacagaata
Mut Sequence:
TTATAGTCACTCTGTGGCCTCAAAGATACATCCTTtgaaagacccccgaggtgggtagtcaatcaatctgaggagaccctcccaaggatcagcgagaccacgattcggatgtaaacagcaagaggctttattgggaacacgggtacccgggcgactcagtctgtcggaggactggcgcgccgagtgtggggtttttaccctttttatagggctggggagcaaaaagcgt
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 36815 | TGT GGC CTC AAA GAT ACA TCC | Common | A | |||
| 36816 | TGA TCC TTG GGA GGG TCT C | Mutant Reverse | A | |||
| 36817 | GGA TCA ATA CAA ACC TGC ACA AC | Wild type Reverse | A | |||
| 36818 | Fluorophore-1 | ACC CCC GAG GTG GGT AGT CA | Quencher-1 | MUT Probe | ||
| 36819 | Fluorophore-2 | TGG CAC ATC ATG TCT ACT ACT GTT ATG A | Quencher-2 | WT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 36815 | 0.40 uM |
| 36816 | 0.40 uM |
| 36817 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
| Stock Number | Strain Name |
|---|---|
| 037206 | B6.129-Optntm1.1Htse/J |
| 004202 | B6.C3 Pde6brd1 Hps4le/+ +-Lmx1adr-8J/J |
| 000002 | B6.C3-Pde6brd1 Hps4le/J |
| 006576 | B6.FVB-Tg(GNAT2-Dta)98Wwk/J |
| 004462 | B6;C3-Tg(APPswe,PSEN1dE9)85Dbo/Mmjax |
| 028590 | B6C3-Tg(tetO/Prnp-TARDBP*)2Vle/J |
| 000235 | B6C3Fe a/a-Relnrl/J |
| 001924 | B6EiC3Sn a/A-Ts(1716)65Dn/J |
| 004850 | B6EiC3Sn-Rb(12.Ts171665Dn)2Cje/CjeDnJ |
| 004861 | B6EiC3Sn-Ts(16C-tel)1Cje/DnJ |
| 006554 | B6SJL-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax |
| 001957 | C3A Pde6brd1.O20/A-Prph2Rd2/J |
| 001979 | C3A.Cg-Pde6b+ Prph2Rd2/J |
| 024703 | C3A.Cg-Pde6b+Tg(Thy1-CFP)23Jrs/SjJ |
| 006435 | C3Fe.SW-Soaa/MonJ |
| 003648 | C3Sn.BLiA-Pde6b+/DnJ |
| 000654 | CBA/CaJ |
| 000656 | CBA/J |
| 004624 | FVB.129P2-Pde6b+ Tyrc-ch Fmr1tm1Cgr/J |
| 004828 | FVB.129P2-Pde6b+ Tyrc-ch/AntJ |
| 022880 | FVB.Cg-Pde6b+ Lrrk1tm1.1Mjff Tyrc-ch/J |
| 002019 | NU/J |
| 003342 | STOCK Hbatm1Paz Hbbtm1Tow Tg(HBA-HBBs)41Paz/J |
| 013169 | STOCK Nphp1tm1Jgg/J |
| 005441 | STOCK Tg(CAG-DsRed*MST)1Nagy/J |
| 004808 | STOCK Tg(MAPT)8cPdav Mapttm1(EGFP)Klt/J |
| 010815 | STOCK Tg(mI56i-flpe)39Fsh/J |
| 27 strains use this protocol | |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.