For in-depth product & services help, ask our
Technical Information Scientists
Notes
A ~1500 bp read-through band may be amplified from the mutant allele.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = ~500 bp
Heterozygote = 210 bp and ~500 bp
Wild type=210 bp
Heterozygote = 210 bp and ~500 bp
Wild type=210 bp
Separated by gel electrophoresis on a 1.5% agarose gel.
Sequence
Wt Sequence:
ggctccaaattagtgtgtcctacagcttggcctgttctgtgcctccgtctagcttgagctattaggggaccagtcaatactcgctaagattctccagaaccatcagggcaccccaacccttatgcaaatgctcagtcaccccaagacttggcttgaccctccctctctgtgtcccttcatagAGGGGGAGGTGAATGCTGAGGAGGAAGGCTTTGAGAACCTGTGGACCACTGCCTCCACCTTCATCGTCCTCTTCCTCCTGAGCCTCTTCTACAGCACCACCGTCACCCTGTTCAAGgtagtgtggttgtggggctgag
Mutant Sequence:
TATTAGGGGACCAGTCAATACTCGCTAAGATTCTCCAGAACCATCAGGGCACCCCAACCCTTATGCAAATGCTCAGTCACCCCAAGACTTGGCTTGACCCTCCCTCTCTGTGTCCCTTCATAGAGGGGTAGTCGAGCAGTGTGGTTTTCAAGAGGAAGCAAAAAGCCTCTCCACCCAGGCCTGGAATGTTTCCACCCAATGTCGAGCAGTGTGGTTTTGCAAGAGGAAGCAAAAAGCCTCTCCACCCAGGCCTGGAATGTTTCCACCCAATGTCGAGCAAACCCCGCCCAGCGTCTTGTCATTGGCGAATTCGAACACGC
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| oIMR1750 | CCG TCT AGC TTG AGC TAT TAG G | Common | A | |||
| oIMR1751 | GAA GAG GAC GAT GAA GGT GG | Wild type | A | |||
| oIMR5255 | TTG TGC CCA GTC ATA GCC GAA T | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| oIMR1750 | 0.50 uM |
| oIMR1751 | 0.50 uM |
| oIMR5255 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 002249 | B10.129S2(B6)-Ighmtm1Cgn/J |
| 002288 | B6.129S2-Ighmtm1Cgn/J |
| 004349 | C.129S2-Ighmtm1Cgn/J |
| 004639 | NOD.129S2(B6)-Ighmtm1Cgn/DoiJ |
| 003903 | NOD.129S2(B6)-Ighmtm1Cgn/Dvs |
| 006608 | NOD.Cg-Ighmtm1Cgn Tg(IghelMD4)4Ccg/DvsJ |
| 005309 | NODCaj.Cg-Ighmtm1Cgn Tg(Igh-VB1-8/Igh-6)2Mjsk/FswJ |
| 005306 | NODCaj.Cg-Ighmtm1Cgn Tg(Igh-VB1-8/Igh-6m)1Mjsk/FswJ |
| 8 strains use this protocol | |