For in-depth product & services help, ask our
Technical Information Scientists
Notes
Mut =A
WT= G
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Sequence
ATCCAGGCTTTTACAGAAATTATATTGAGCCTTACTTGGAACAAGCCAGTCGTATCTGGCCATGGCTtcttgGGGCA(G/A)CACTGGTGGGA
GCTGTTATTGCTGCAGCTCTCTCTGGGCTTAGCAGTAGGCTATGCCTTCAGAAGAAGAAGAAGAAGAAGCAACCCCAGGAGGAAAGGC
AGCCACTCCTCATGGACAAAGACGACTACCACAGCTTGCTGTATCAGAGCCATCTGTGAACATCCT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 33865 | CAG CTT GAT CTC TTT CTA TTT CAG A | Forward | A | |||
| 33866 | AGC CAA ACA GCT ATG GTC TAT GT | Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 33865 | 0.50 uM |
| 33866 | 0.50 uM |
| Glycerol | 6.50 % |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 034245 | FVB(129P2)-Pde6b+ Gtf2iem2Jdd Gtf2ird1em2Jdd Tyrc-ch/Mmjax |
| 034672 | FVB(129P2)-Pde6b+ Gtf2ird1em3Jdd Tyrc-ch/Mmjax |
| 004624 | FVB.129P2-Pde6b+ Tyrc-ch Fmr1tm1Cgr/J |
| 004828 | FVB.129P2-Pde6b+ Tyrc-ch/AntJ |
| 038293 | FVB.Cg-Pde6b+ Tyrc-ch Ccdc198em1Iad/J |
| 000271 | SH1/LeJ |
| 6 strains use this protocol | |