Protocol 21446: Probe Assay - Smn1<tm1Msd> Probe Alternate2
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  115 bp

Wild Type = 126 bp

Sequence

Wt Sequence: ttaagcacatctatctataacttattttttattttttctccctcttcagagTGATGATTCTGACATTTGGGATGATACAGCATTGATAAAAGcttaTGATAAAGCTGTGGCTTCCTTTAAGgtatgaaatggttaatcatttttttcc

ttatttcctcaggtcat

 

Mutant Sequence: CTCCCTCTTCAGAGTGATGATTCTGACATTTGGGATGATACAGCATTGATAAAAGctcatTCCGCGGGTTTTCATGTACCCAGCATGGGGGATCCCGTCGTTTTACAACGTCGT

GACTGGGAAAACCCTGGCGTT

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
14849 GAT GAT TCT GAC ATT TGG GAT G Common A
31897 Fluorophore-1 TGA TAA AAG CTT ATG ATA AAG CTG TGG Quencher-1 WT Probe
32466 CTT TAC AAA ATG TAT GAC CTG AGG A Wild type Reverse A
32467 AGG GTT TTC CCA GTC ACG Mutant Reverse A LacZ
32468 Fluorophore-2 TTT CAT GTA CCC AGC ATG GG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
14849 0.40 uM
32466 0.40 uM
32467 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
007222 B6.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN1*A2G)2023Ahmb/J
006964 B6.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/J
006773 B6.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd/J
008629 B6.Cg-Tg(SMN2)11Tro Smn1tm1Msd/J
008631 B6.Cg-Tg(SMN2)11Tro Tg(SMN2)46Tro Smn1tm1Msd/J
008630 B6.Cg-Tg(SMN2)46Tro Smn1tm1Msd/J
006385 B6;129P2-Syt1tm3Sud/J
006386 B6;129P2-Syt1tm5Sud/J
006214 FVB.129P2-Smn1tm1Msd/J
008782 FVB.Cg-Grm7Tg(SMN2)89Ahmb Tg(SMN2*A111G)588Ahmb Smn1tm1Msd/J
008209 FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(ACTA1-SMN)69Ahmb/J
007968 FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN1*A2G)2023Ahmb/2J
005026 FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN1*A2G)2023Ahmb/J
009134 FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*A111G)591Ahmb/J
007952 FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/2J
005025 FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/J
031906 FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2-SMN1*T274I)5Ahmb/J
007949 FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd/2J
005024 FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd/J
030214 FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Prnp-PLS3)14Ahmb Tg(SMN2*delta7)4299Ahmb/J
030970 FVB.Cg-Mapk10tm1Flv Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/LganJ
034287 FVB.Cg-Smn1tm1Msd Tg(SMN2)1Cdid/J
008206 FVB.Cg-Smn1tm1Msd Tg(SMN2)566Ahmb/J
031909 FVB.Cg-Tg(SMN2*A111G)588Ahmb Tg(SMN2-SMN1*Q282A)2Ahmb Smn1tm1Msd/J
031907 STOCK Grm7Tg(SMN2)89Ahmb Tg(SMN2-SMN1*Q282A)2Ahmb Smn1tm1Msd/J
008203 STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(ACTA1-SMN)63Ahmb/J
006553 STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(H2-K1-tsA58)6Kio Tg(SMN2*delta7)4299Ahmb/J
032003 STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Hlxb9-GFP)1Tmj Tg(SMN2*delta7)4299Ahmb/J
006570 STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Hlxb9-GFP)1Tmj/J
008212 STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Prnp-SMN)92Ahmb/J
025102 STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch/DaschMmjax
018916 STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN1-SMN2*)16Cll/CllJ
031908 STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2-SMN1*D44V)10Ahmb/J
008783 STOCK Grm7Tg(SMN2)89Ahmb Smn1tm3(SMN2/Smn1)Mrph Tg(CAG-cre/Esr1*)5Amc Tg(SMN2*delta7)4299Ahmb/J
017596 STOCK Gt(ROSA)26Sortm1.1(rtTA,EGFP)Nagy Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb Tg(tetO-SMN2,-luc)#aAhmb/J
017597 STOCK Gt(ROSA)26Sortm1.1(rtTA,EGFP)Nagy Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb Tg(tetO-SMN2,-luc)#bAhmb/J
007022 STOCK Mnx1tm4(cre)Tmj Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/J
37 strains use this protocol