Protocol 21446: Probe Assay - Smn1<tm1Msd> Probe Alternate2

STOCK Grm7^{Tg(SMN2)89Ahmb} Smn1^tm1Msd Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch/DaschMmjax

Stock No: 025102

Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  115 bp

Wild Type = 126 bp

Sequence

Wt Sequence: ttaagcacatctatctataacttattttttattttttctccctcttcagagTGATGATTCTGACATTTGGGATGATACAGCATTGATAAAAGcttaTGATAAAGCTGTGGCTTCCTTTAAGgtatgaaatggttaatcatttttttcc

ttatttcctcaggtcat

 

Mutant Sequence: CTCCCTCTTCAGAGTGATGATTCTGACATTTGGGATGATACAGCATTGATAAAAGctcatTCCGCGGGTTTTCATGTACCCAGCATGGGGGATCCCGTCGTTTTACAACGTCGT

GACTGGGAAAACCCTGGCGTT

JAX Protocol

Protocol Primers

Primer	5' Label	Sequence 5' → 3'	3' Label	Primer Type	Reaction	Note
14849		GAT GAT TCT GAC ATT TGG GAT G		Common	A
31897	Fluorophore-1	TGA TAA AAG CTT ATG ATA AAG CTG TGG	Quencher-1	WT Probe
32466		CTT TAC AAA ATG TAT GAC CTG AGG A		Wild type Reverse	A
32467		AGG GTT TTC CCA GTC ACG		Mutant Reverse	A	LacZ
32468	Fluorophore-2	TTT CAT GTA CCC AGC ATG GG	Quencher-2	MUT Probe

Reaction A

Component	Final Concentration
Kapa Probe Fast QPCR	1.00 X
ddH2O
14849	0.40 uM
32466	0.40 uM
32467	0.40 uM
Wt Probe	0.15 uM
Mutant Probe	0.15 uM
DNA

Cycling

Step	Temp °C	Time	Note
1	95.0	--
2	95.0	--
3	60.0	--
4		--	repeat steps 2-3 for 40 cycles
5	40.0	--	Forever

JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number	Strain Name
007222	B6.Cg-Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(SMN1*A2G)2023Ahmb/J
006964	B6.Cg-Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(SMN2*delta7)4299Ahmb/J
006773	B6.Cg-Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd/J
008629	B6.Cg-Tg(SMN2)11Tro Smn1^tm1Msd/J
008631	B6.Cg-Tg(SMN2)11Tro Tg(SMN2)46Tro Smn1^tm1Msd/J
008630	B6.Cg-Tg(SMN2)46Tro Smn1^tm1Msd/J
006385	B6;129P2-Syt1^tm3Sud/J
006386	B6;129P2-Syt1^tm5Sud/J
006214	FVB.129P2-Smn1^tm1Msd/J
008782	FVB.Cg-Grm7^Tg(SMN2)89Ahmb Tg(SMN2*A111G)588Ahmb Smn1^tm1Msd/J
008209	FVB.Cg-Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(ACTA1-SMN)69Ahmb/J
007968	FVB.Cg-Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(SMN1*A2G)2023Ahmb/2J
005026	FVB.Cg-Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(SMN1*A2G)2023Ahmb/J
009134	FVB.Cg-Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(SMN2*A111G)591Ahmb/J
007952	FVB.Cg-Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(SMN2*delta7)4299Ahmb/2J
005025	FVB.Cg-Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(SMN2*delta7)4299Ahmb/J
031906	FVB.Cg-Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(SMN2-SMN1*T274I)5Ahmb/J
007949	FVB.Cg-Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd/2J
005024	FVB.Cg-Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd/J
030214	FVB.Cg-Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(Prnp-PLS3)14Ahmb Tg(SMN2*delta7)4299Ahmb/J
030970	FVB.Cg-Mapk10^tm1Flv Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(SMN2*delta7)4299Ahmb/LganJ
034287	FVB.Cg-Smn1^tm1Msd Tg(SMN2)1Cdid/J
008206	FVB.Cg-Smn1^tm1Msd Tg(SMN2)566Ahmb/J
031909	FVB.Cg-Tg(SMN2*A111G)588Ahmb Tg(SMN2-SMN1*Q282A)2Ahmb Smn1^tm1Msd/J
031907	STOCK Grm7^Tg(SMN2)89Ahmb Tg(SMN2-SMN1*Q282A)2Ahmb Smn1^tm1Msd/J
008203	STOCK Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(ACTA1-SMN)63Ahmb/J
006553	STOCK Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(H2-K1-tsA58)6Kio Tg(SMN2*delta7)4299Ahmb/J
032003	STOCK Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(Hlxb9-GFP)1Tmj Tg(SMN2*delta7)4299Ahmb/J
006570	STOCK Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(Hlxb9-GFP)1Tmj/J
008212	STOCK Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(Prnp-SMN)92Ahmb/J
025102	STOCK Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch/DaschMmjax
018916	STOCK Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(SMN1-SMN2*)16Cll/CllJ
031908	STOCK Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(SMN2-SMN1*D44V)10Ahmb/J
008783	STOCK Grm7^Tg(SMN2)89Ahmb Smn1^tm3(SMN2/Smn1)Mrph Tg(CAG-cre/Esr1*)5Amc Tg(SMN2*delta7)4299Ahmb/J
017596	STOCK Gt(ROSA)26Sor^tm1.1(rtTA,EGFP)Nagy Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(SMN2*delta7)4299Ahmb Tg(tetO-SMN2,-luc)#aAhmb/J
017597	STOCK Gt(ROSA)26Sor^tm1.1(rtTA,EGFP)Nagy Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(SMN2*delta7)4299Ahmb Tg(tetO-SMN2,-luc)#bAhmb/J
007022	STOCK Mnx1^tm4(cre)Tmj Grm7^Tg(SMN2)89Ahmb Smn1^tm1Msd Tg(SMN2*delta7)4299Ahmb/J
37 strains use this protocol