The SMA/U7 mice harbor several mutations/transgenes, as described below.
Creation of the Tg(SMN2)89 transgene (SMN2) and Smn1 null allele (Smn1tm1Msd; also called Smn-) are described for the severe type I SMA mouse model on an FVB/NJ background (JAX Stock No. 005024). The Tg(SMN2)89 transgene insertion site is on chromosome 6. These FVB.SMN2;Smn- mice were maintained on an FVB/NJ background prior to being used as below.
The U7-ESE-B transgenic mice were created by Dr. Daniel Schuemperli (Institute of Cell Biology [IZB], University of Bern, Switzerland) using a lentiviral transgenic approach. The U7-ESE-B splicing correction cassette encodes a tailed antisense oligonucleotide directed to the 3prime part of human SMN2 exon 7 and an additional splicing enhancer sequence. To create this cassette, a 570 bp region of the U7 wildtype gene (Rnu7) was obtained containing 341 bp 5prime flanking sequence (including the distal and proximal sequence promoter elements [DSE and PSE]), 62 bp U7 snRNA coding region and 167 bp 3prime sequence (including the 3prime box). Next, several in vitro modifications were made within the U7 snRNA coding region, as detailed below.
The 5’GGA non-complementary "tail" sequence (GGAGGACGGAGGACGGAGGAC), predicted to mimic the exonic splicing enhancer (ESE) sequence of an SF2/ASF/SRSF1 binding site, was introduced.
The antisense sequence complementary to the histone downstream element in replication-dependent histone pre-mRNAs was changed to a sequence binding to positions 33-50 in the 3prime region (position B [also called B1]) of the weak exon 7 of human SMN2.
The Sm binding site (aatttGtCT) was changed to the Sm OPT sequence (aatttTtGG ; corresponding to the consensus sequence found in spliceosomal snRNAs). As a consequence, the resulting snRNA no longer binds the U7-specific Sm-like proteins Lsm10 and Lsm11, but rather the five standard Sm proteins found in spliceosomal snRNPs. These changes in snRNP assembly render the RNA non-functional for histone RNA processing and additionally allow it to accumulate in cell nuclei ~3 times more efficiently.
The resulting U7-ESE-B splicing correction cassette was introduced into the third generation (self-inactivating) lentiviral vector pRRL-SIN-cPPT-hPGK-GFP-WPRE. The resulting ~4.4 kbp transgene had U7-ESE-B inserted upstream of the hPGK promoter and in sense orientation with EGFP.
Lentiviral transgenesis was performed by perivitelline injection into B6D2G1 (derived from C57BL/6J x DBA/2J mice) fertilized oocytes. Founder female epfl-4 (brown coat color and 27.8 transgene copy number) was bred to a male FVB.SMN2;Smn- (JAX Stock No. 005024) to generate germline carriers. The triple mutant colony was maintained by breeding mice homozygous for the SMN2 transgene, heterozygous for the Smn1 null allele and harboring the U7-ESE-B transgene (SMN2+/+;Smn+/-;U7-ESE-B+) together for more than 15 generations. The colony was bred to FVB.SMN2;Smn- (JAX Stock No. 005024) for ~2-4 generations overall. The donating investigator reports U7-ESE-B transgene copy number is variable, selected breeders with higher copy number and suggests at least some of the transgene copies are linked. In 2016, SMN2+/+;Smn+/-;U7-ESE-B+ mice with ~8 copies of U7-ESE-B (and gray or white coat color) were sent to the Mutant Mouse Regional Resource Center node at The Jackson Laboratory (MMRRC-JAX).
The third generation lentiviral vector pRRL-SIN-cPPT-hPGK-GFP-WPRE is composed of U3 sequences from Rous sarcoma virus (RSV-RU5), HIV-1 packaging signal (Ψ), HIV-1 central polypurine tract (cPPT), human phosphoglycerate kinase promoter, enhanced green fluorescent protein gene (EGFP), woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) and self-inactivating deletions in the U3 region of the 3prime LTR.
