Overview

Also Known As:SMA/U7

The SMA/U7 triple mutant mouse (SMN2+/+;Smn-/-;U7-ESE-B+) harbors the Tg(SMN2)89 transgene and Smn1 null allele described for the severe type I spinal muscular atrophy (SMA) mouse model, as well as the U7-ESE-B transgene designed to correct the human SMN2 splicing defect and result in amelioration of SMA phenotype.

Donating Investigator

Daniel Schuemperli, Institute of Cell Biology, University of Bern

Genetic overview

Genetic Background	Generation

Grm7^{Tg(SMN2)89Ahmb}

Allele Type
Transgenic (Hypomorph, Inserted expressed sequence, Humanized sequence)

Smn1^tm1Msd

Allele Type	Gene Symbol	Gene Name
Targeted (Reporter, Null/Knockout)	Smn1	survival motor neuron 1

Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch

Allele Type
Transgenic (Reporter, Knockdown)

View Genetics

Research Applications

Research Tools
Neurobiology Research
Developmental Biology Research

View All Research Applications

Details

Detailed Description

Mice homozygous for the Tg(SMN2)89 transgene, homozygous for Smn1 null and harboring the U7-ESE-B transgene (SMN2+/+;Smn-/-;U7-ESE-B+) are the triple mutant mouse model called SMA/U7. They harbor the Tg(SMN2)89 transgene and Smn1 null allele described for the severe type I spinal muscular atrophy (SMA) mouse model, as well as the U7-ESE-B transgene designed to correct the SMA-causitive SMN2 splicing defect and ameliorate SMA phenotype. Details are below.

The Tg(SMN2)89Ahmb transgene expresses the entire human SMN2 gene, whereas no endogenous Smn1 expression is observed from the Smn1 null allele (Smn1^tm1Msd). Mice homozygous for Tg(SMN2)89 (SMN2+/+) and homozygous for Smn1 null (Smn-/-) are a severe type I SMA mouse model that, when coisogenic on an FVB/NJ genetic background (JAX Stock No. 005024 ; FVB.SMN2+/+;Smn-/-), exhibits symptoms, neuropathology and early lethality (4-7 days) similar to human type I SMA patients.

As an addition to that SMA model, the SMA/U7 strain also harbors the U7-ESE-B transgene containing the therapeutic U7-ESE-B cassette as well as a hPGK1 promoter-driven EGFP. The U7-ESE-B cassette encodes an antisense oligonucleotide specifically directed to the 3prime region of human SMN2 gene exon 7 (known to have the single nucleotide difference that disrupts an SF2/ASF/SRSF1 binding site-containing exonic splicing enhancer) with a "tail" of additional exonic splicing enhancer motifs to provide trans-acting enhancers.

Mice homozygous for Tg(SMN2)89, homozygous for Smn1 null and harboring the U7-ESE-B transgene (SMN2+/+;Smn-/-;U7-ESE-B+) are called SMA/U7. The U7-ESE-B oligonucleotide has been shown to have nearly complete exon 7 inclusion into SMN1 and ~89% inclusion into SMN2 in cell culture models. The U7-ESE-B transgene copy number is variable (see protocol information below), and SMA/U7 mice with higher U7-ESE-B copy number show greater phenotype rescue. Specifically, SMA/U7 mice with ~one U7-ESE-B transgene copy survive up to 3 weeks. SMA/U7 mice with ~five U7-ESE-B transgene copies exhibit life extension to more than one year, and an almost complete recovery of muscle functions and other disease parameters. The phenotype described above is for SMA/U7 mice on a mixed FVB/N, C57BL/6J, DBA/2J genetic background. The donating investigator reports that this mixed background generally results in a more severe SMA phenotype when compared to mice of the same genotype on an FVB genetic background. EGFP fluorescence is observed in blood samples.

The donating investigator's qPCR protocol for quantifying the U7-ESE-B transgene copy number is available here.

Development

The SMA/U7 mice harbor several mutations/transgenes, as described below.

Creation of the Tg(SMN2)89 transgene (SMN2) and Smn1 null allele (Smn1^tm1Msd; also called Smn-) are described for the severe type I SMA mouse model on an FVB/NJ background (JAX Stock No. 005024). The Tg(SMN2)89 transgene insertion site is on chromosome 6. These FVB.SMN2;Smn- mice were maintained on an FVB/NJ background prior to being used as below.

The U7-ESE-B transgenic mice were created by Dr. Daniel Schuemperli (Institute of Cell Biology [IZB], University of Bern, Switzerland) using a lentiviral transgenic approach. The U7-ESE-B splicing correction cassette encodes a tailed antisense oligonucleotide directed to the 3prime part of human SMN2 exon 7 and an additional splicing enhancer sequence. To create this cassette, a 570 bp region of the U7 wildtype gene (Rnu7) was obtained containing 341 bp 5prime flanking sequence (including the distal and proximal sequence promoter elements [DSE and PSE]), 62 bp U7 snRNA coding region and 167 bp 3prime sequence (including the 3prime box). Next, several in vitro modifications were made within the U7 snRNA coding region, as detailed below.
The 5’GGA non-complementary "tail" sequence (GGAGGACGGAGGACGGAGGAC), predicted to mimic the exonic splicing enhancer (ESE) sequence of an SF2/ASF/SRSF1 binding site, was introduced.
The antisense sequence complementary to the histone downstream element in replication-dependent histone pre-mRNAs was changed to a sequence binding to positions 33-50 in the 3prime region (position B [also called B1]) of the weak exon 7 of human SMN2.
The Sm binding site (aatttGtCT) was changed to the Sm OPT sequence (aatttTtGG ; corresponding to the consensus sequence found in spliceosomal snRNAs). As a consequence, the resulting snRNA no longer binds the U7-specific Sm-like proteins Lsm10 and Lsm11, but rather the five standard Sm proteins found in spliceosomal snRNPs. These changes in snRNP assembly render the RNA non-functional for histone RNA processing and additionally allow it to accumulate in cell nuclei ~3 times more efficiently.

The resulting U7-ESE-B splicing correction cassette was introduced into the third generation (self-inactivating) lentiviral vector pRRL-SIN-cPPT-hPGK-GFP-WPRE. The resulting ~4.4 kbp transgene had U7-ESE-B inserted upstream of the hPGK promoter and in sense orientation with EGFP.
Lentiviral transgenesis was performed by perivitelline injection into B6D2G1 (derived from C57BL/6J x DBA/2J mice) fertilized oocytes. Founder female epfl-4 (brown coat color and 27.8 transgene copy number) was bred to a male FVB.SMN2;Smn- (JAX Stock No. 005024) to generate germline carriers. The triple mutant colony was maintained by breeding mice homozygous for the SMN2 transgene, heterozygous for the Smn1 null allele and harboring the U7-ESE-B transgene (SMN2+/+;Smn+/-;U7-ESE-B+) together for more than 15 generations. The colony was bred to FVB.SMN2;Smn- (JAX Stock No. 005024) for ~2-4 generations overall. The donating investigator reports U7-ESE-B transgene copy number is variable, selected breeders with higher copy number and suggests at least some of the transgene copies are linked. In 2016, SMN2+/+;Smn+/-;U7-ESE-B+ mice with ~8 copies of U7-ESE-B (and gray or white coat color) were sent to the Mutant Mouse Regional Resource Center node at The Jackson Laboratory (MMRRC-JAX).

The third generation lentiviral vector pRRL-SIN-cPPT-hPGK-GFP-WPRE is composed of U3 sequences from Rous sarcoma virus (RSV-RU5), HIV-1 packaging signal (Ψ), HIV-1 central polypurine tract (cPPT), human phosphoglycerate kinase promoter, enhanced green fluorescent protein gene (EGFP), woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) and self-inactivating deletions in the U3 region of the 3prime LTR.

Expression Data

Expressed Gene	SMN2, survival of motor neuron 2, centromeric, human
Site of Expression	Grm7^{Tg(SMN2)89Ahmb}
Expressed Gene	lacZ, beta-galactosidase, E. coli
Site of Expression	The expression of the lacZ gene in tissues where Smn is normally expressed was noted.
Expressed Gene	SMN2, survival of motor neuron 2, centromeric, human
Expressed Gene	GFP, Green Fluorescent Protein,
Site of Expression	EGFP fluorescence is observed in blood samples.

Control Suggestions

Wild-type from the colony
Noncarrier

Approximate Controls

Depending upon the experiment, the following may be appropriate control strain(s):
--Mice harboring the Tg(SMN2)89 transgene (SMN2) and Smn1 null targeted mutation (Smn1^tm1Msd; also called Smn-) are described for the severe type I SMA mouse model. Such mice are available on an FVB/NJ genetic background (fully congenic N10 [007949] or incipient congenic N5 [Stock No. 005024]), and a C57BL/6J genetic background (Stock No. 006773).

Additional Information

Considerations for Choosing Controls

Genetics

Grm7^{Tg(SMN2)89Ahmb}

Allele Symbol: Grm7^{Tg(SMN2)89Ahmb}

Allele Name	transgene insertion 89, Arthur H M Burghes
Allele Type	Transgenic (Hypomorph, Inserted expressed sequence, Humanized sequence)
Allele Synonym(s)	SMN2
Gene Symbol and Name	Grm7, glutamate receptor, metabotropic 7
Gene Synonym(s)
Promoter	SMN2, survival of motor neuron 2, centromeric, human
Expressed Gene	SMN2, survival of motor neuron 2, centromeric, human
Site of Expression	Grm7^{Tg(SMN2)89Ahmb}
Strain of Origin	FVB/N
Chromosome	6
Molecular Note	A 35.5 kb genomic fragment containing the human survival motor neuron 2 (SMN2) gene and promoter was used for the transgene. The transgene is ubiquitously expressed in all tissues examined by Northern blot analysis. Line 89 carries 1 copy of the transgene integrated into intron 4 of the gene. RT-PCR confirmed reduced expression of the gene the transgene is integrated into.
Mutations Made By	Arthur Burghes, The Ohio State University

Smn1^tm1Msd

Allele Symbol: Smn1^tm1Msd

Allele Name	targeted mutation 1, Michael Sendtner
Allele Type	Targeted (Reporter, Null/Knockout)
Allele Synonym(s)	SMN^-
Gene Symbol and Name	Smn1, survival motor neuron 1
Gene Synonym(s)
Expressed Gene	lacZ, beta-galactosidase, E. coli
Site of Expression	The expression of the lacZ gene in tissues where Smn is normally expressed was noted.
Strain of Origin	129P2/OlaHsd
Chromosome	13
Molecular Note	A lacZ-neo cassette was inserted into exon 2 by homologous recombination resulting in an in-frame fusion of lacZ to exon 2. Homozygous mutant embryos were identified up to 80 hours post coitum. The expression of the lacZ gene in tissues where Smn is normally expressed was noted.
Mutations Made By	Michael Sendtner

Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch

Allele Symbol: Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch

Allele Name	transgene insertion 4, Daniel Schuemperli
Allele Type	Transgenic (Reporter, Knockdown)
Allele Synonym(s)	U7-ESE-B
Gene Symbol and Name	Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch, transgene insertion 4, Daniel Schuemperli
Gene Synonym(s)
Promoter	PGK1, phosphoglycerate kinase 1, human
Promoter	Rnu7, U7 small nuclear RNA, mouse, laboratory
Expressed Gene	SMN2, survival of motor neuron 2, centromeric, human
Expressed Gene	GFP, Green Fluorescent Protein,
Site of Expression	EGFP fluorescence is observed in blood samples.
Strain of Origin	C57BL/6J x DBA/2J
Chromosome	UN
Molecular Note	The U7-ESE-B splicing correction cassette encodes a tailed antisense oligonucleotide directed to the 3' part of human SMN2 exon 7 and an additional splicing enhancer sequence. To create this cassette, a 570 bp region of the U7 wild-type gene (Rnu7) was obtained containing 341 bp 5' flanking sequence (including the distal and proximal sequence promoter elements [DSE and PSE]), 62 bp U7 snRNA coding region and 167 bp 3' sequence (including the 3' box). The 5'GGA non-complementary "tail" sequence (GGAGGACGGAGGACGGAGGAC), predicted to mimic the exonic splicing enhancer (ESE) sequence of an SF2/ASF/SRSF1 binding site, was introduced. The antisense sequence complementary to the histone downstream element in replication-dependent histone pre-mRNAs was changed to a sequence binding to positions 33-50 in the 3' region (position B [also called B1]) of the weak exon 7 of human SMN2. The Sm binding site (aatttGtCT) was changed to the Sm OPT sequence (aatttTtGG ; corresponding to the consensus sequence found in spliceosomal snRNAs). As a consequence, the resulting snRNA no longer binds the U7-specific Sm-like proteins Lsm10 and Lsm11 but rather the five standard Sm proteins found in spliceosomal snRNPs. These changes in snRNP assembly render the RNA non-functional for histone RNA processing and additionally allow it to accumulate in cell nuclei about 3 times more efficiently. The resulting U7-ESE-B splicing correction cassette was introduced into the third generation (self-inactivating) lentiviral vector pRRL-SIN-cPPT-hPGK-GFP-WPRE. The resulting approximate 4.4 kbp transgene had the U7-ESE-B inserted upstream of the hPGK promoter and in sense orientation with EGFP. Line 4 has 8 copies of the transgene.

Disease/Phenotype

Disease Terms

Research Areas By Phenotype

This mouse can be used to support research in many areas including:

Research Tools
- Neurobiology Research
- Fluorescent Proteins
- lacZ Expression
Neurobiology Research
- Neuromuscular defects
- Neurodevelopmental Defects
- Ataxia (Movement) Defects
- Neurodegeneration
- Spinal Muscular Atrophy (SMA)
- Fluorescent protein expression in neural tissue
- lacZ expression in neural tissue
Developmental Biology Research
- Neurodevelopmental Defects

Genotype: Smn1^tm1Msd related

Neurobiology Research
- Spinal Muscular Atrophy (SMA)

Mammalian Phenotype Terms by Genotype

References

Additional - Grm7^{Tg(SMN2)89Ahmb} related

Additional - Smn1^tm1Msd related

Additional - Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch related

Technical Support

CONTACT TECHNICAL SUPPORT

Genotyping Protocols
- QPCR:Tg(Rnu7*SMN2,PGK1-EGFP)4Dasch
- Standard PCR:Grm7
- Standard PCR:Smn1
- Probe:Grm7-Probe
- Genotyping resources and troubleshooting
Breeding Considerations

The Tg(SMN2)89 transgene (SMN2) on chromosome 6, the Smn1 null targeted mutation (Smn1^tm1Msd or Smn-) on chromosome 13, and the randomly inserted U7-ESE-B transgene are not linked and will segregate independently.

Mice homozygous for Tg(SMN2)89Ahmb, homozygous for Smn1 null and carrying the U7-ESE-B transgene (SMN2+/+;Smn-/-;U7-ESE-B+) are called SMA/U7.

The Mutant Mouse Regional Resource Center node at The Jackson Laboratory (MMRRC-JAX) will maintain the live colony by breeding mice homozygous for Tg(SMN2)89Ahmb, heterozygous for Smn1 null, and carrying U7-ESE-B with mice homozygous for Tg(SMN2)89Ahmb, wildtype at the Smn1 locus and carrying U7-ESE-B.

The donating investigator reports U7-ESE-B transgene copy number is variable (suggests at least some of the transgene copies are linked), and SMA/U7 mice with higher U7-ESE-B copy number show greater phenotype rescue.

The donating investigator's qPCR protocol for quantifying the U7-ESE-B transgene copy number is available here.
- Additional Breeding and Husbandry Support
Citation
When using the SMA/U7 mouse strain in a publication, please cite the originating article(s) and include MMRRC stock #41843 in your Materials and Methods section.

Animal Health Reports

Facility Barrier Level Descriptions

Production of mice from cryopreserved embryos or sperm occurs in a maximum barrier room, G200

Terms Of Use

General Terms and Conditions

See MMRRC for Additional Conditions of Distribution

Questions about Terms of Use

Licensing Information

Phone: 207-288-6470

Email: TechTran@jax.org

JAX® Mice, Products & Services Conditions of Use

"MICE" means mouse strains, their progeny derived by inbreeding or crossbreeding, unmodified derivatives from mouse strains or their progeny supplied by The Jackson Laboratory ("JACKSON"). "PRODUCT(S)" means biological materials supplied by JACKSON, and their derivatives. "SERVICES" means projects conducted by JACKSON for other parties that may include but are not limited to the use of MICE or PRODUCTS. "RECIPIENT" means each recipient of MICE, PRODUCTS, or SERVICES provided by JACKSON including each institution, its employees and other researchers under its control. MICE or PRODUCTS shall not be: (i) used for any purpose other than internal research, (ii) sold or otherwise provided to any third party for any use, or (iii) provided to any agent or other third party to provide breeding or other services. Acceptance of MICE, PRODUCTS or SERVICES from JACKSON shall be deemed as agreement by RECIPIENT to these conditions, and departure from these conditions requires JACKSON’s prior written authorization.

No Warranty

MICE, PRODUCTS AND SERVICES ARE PROVIDED "AS IS". JACKSON EXTENDS NO WARRANTIES OF ANY KIND, EITHER EXPRESS, IMPLIED, OR STATUTORY, WITH RESPECT TO MICE, PRODUCTS OR SERVICES, INCLUDING ANY IMPLIED WARRANTY OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE, OR ANY WARRANTY OF NON-INFRINGEMENT OF ANY PATENT, TRADEMARK, OR OTHER INTELLECTUAL PROPERTY RIGHTS.

Credit for PRODUCTS or SERVICES

In case of dissatisfaction for a valid reason and claimed in writing by a purchaser within ninety (90) days of receipt of, PRODUCTS or SERVICES, JACKSON will, at its option, provide credit or replacement for the PRODUCT received or the SERVICES provided; JACKSON makes no other representations and this shall be the exclusive remedy of the purchaser. Please note specific policy for live mice.

Animal Care and Use for SERVICES

Consistent with the requirement for a written understanding regarding animal care and use, the JACKSON Animal Care and Use Committee will review the animal care and use protocol(s) associated with any SERVICES to be performed at JACKSON, and JACKSON shall have ultimate responsibility and authority for the care of animals while on site or in JACKSON custody.

No Liability

In no event shall JACKSON, its trustees, directors, officers, employees, and affiliates be liable for any causes of action or damages, including any direct, indirect, special, or consequential damages, arising out of the provision of MICE, PRODUCTS, or SERVICES, including economic damage or injury to property and lost profits, and including any damage arising from acts or negligence on the part of JACKSON, its agents or employees. Unless prohibited by law, in purchasing or receiving MICE, PRODUCTS, or SERVICES from JACKSON, purchaser or recipient, or any party claiming by or through them, expressly releases and discharges JACKSON from all such causes of action or damages, and further agrees to defend and indemnify JACKSON from any costs or damages arising out of any third party claims.

MICE, PRODUCTS or SERVICES are to be used in a safe manner and in accordance with all applicable governmental rules and regulations.

The foregoing represents the General Terms and Conditions applicable to JACKSON’s MICE, PRODUCTS or SERVICES. In addition, special terms and conditions of sale of certain MICE, PRODUCTS, or SERVICES may be set forth separately in JACKSON web pages, catalogs, price lists, contracts, and/or other documents, and these special terms and conditions shall also govern the sale of these MICE, PRODUCTS and SERVICES by JACKSON, and by its licensees and distributors.

Acceptance of delivery of MICE, PRODUCTS or SERVICES shall be deemed agreement to these terms and conditions. No purchase order or other document transmitted by purchaser or recipient that may modify the terms and conditions hereof, shall be in any way binding on JACKSON, and instead the terms and conditions set forth herein, including any special terms and conditions set forth separately, shall govern the sale of MICE, PRODUCTS or SERVICES by JACKSON.

Also Known As:SMA/U7

Donating Investigator

Genetic overview

Research Applications

Detailed Description

Development

Expression Data

Control Suggestions

Approximate Controls

Additional Information

Grm7Tg(SMN2)89Ahmb

Allele Symbol: Grm7Tg(SMN2)89Ahmb

Smn1tm1Msd

Allele Symbol: Smn1tm1Msd

Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch

Allele Symbol: Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch

Disease Terms

Research Areas By Phenotype

This mouse can be used to support research in many areas including:

Genotype: Smn1tm1Msd related

Mammalian Phenotype Terms by Genotype

References

Additional - Grm7Tg(SMN2)89Ahmb related

Additional - Smn1tm1Msd related

Additional - Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch related

Genotyping Protocols

Breeding Considerations

Citation

Animal Health Reports

Production of mice from cryopreserved embryos or sperm occurs in a maximum barrier room, G200

The Jackson Laboratory's Genotype Promise

Terms Of Use

Licensing Information

JAX® Mice, Products & Services Conditions of Use

No Warranty

Credit for PRODUCTS or SERVICES

Animal Care and Use for SERVICES

No Liability

Grm7^{Tg(SMN2)89Ahmb}

Allele Symbol: Grm7^{Tg(SMN2)89Ahmb}

Smn1^tm1Msd

Allele Symbol: Smn1^tm1Msd

Genotype: Smn1^tm1Msd related

Additional - Grm7^{Tg(SMN2)89Ahmb} related

Additional - Smn1^tm1Msd related