STOCK Grm7^{Tg(SMN2)89Ahmb} Smn1^tm1Msd Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch/DaschMmjax

Stock number: 025102
Product name: SMA/U7
Research areas: Developmental Biology Research, Neurobiology Research, Research Tools

Description

The SMA/U7 triple mutant mouse (SMN2+/+;Smn-/-;U7-ESE-B+) harbors the Tg(SMN2)89 transgene and Smn1 null allele described for the severe type I spinal muscular atrophy (SMA) mouse model, as well as the U7-ESE-B transgene designed to correct the human SMN2 splicing defect and result in amelioration of SMA phenotype.

Detailed description

Mice homozygous for the Tg(SMN2)89 transgene, homozygous for Smn1 null and harboring the U7-ESE-B transgene (SMN2+/+;Smn-/-;U7-ESE-B+) are the triple mutant mouse model called SMA/U7. They harbor the Tg(SMN2)89 transgene and Smn1 null allele described for the severe type I spinal muscular atrophy (SMA) mouse model, as well as the U7-ESE-B transgene designed to correct the SMA-causitive SMN2 splicing defect and ameliorate SMA phenotype. Details are below.

The Tg(SMN2)89Ahmb transgene expresses the entire human SMN2 gene, whereas no endogenous Smn1 expression is observed from the Smn1 null allele (Smn1^tm1Msd). Mice homozygous for Tg(SMN2)89 (SMN2+/+) and homozygous for Smn1 null (Smn-/-) are a severe type I SMA mouse model that, when coisogenic on an FVB/NJ genetic background (JAX Stock No. 005024 ; FVB.SMN2+/+;Smn-/-), exhibits symptoms, neuropathology and early lethality (4-7 days) similar to human type I SMA patients.

As an addition to that SMA model, the SMA/U7 strain also harbors the U7-ESE-B transgene containing the therapeutic U7-ESE-B cassette as well as a hPGK1 promoter-driven EGFP. The U7-ESE-B cassette encodes an antisense oligonucleotide specifically directed to the 3prime region of human SMN2 gene exon 7 (known to have the single nucleotide difference that disrupts an SF2/ASF/SRSF1 binding site-containing exonic splicing enhancer) with a "tail" of additional exonic splicing enhancer motifs to provide trans-acting enhancers.

Mice homozygous for Tg(SMN2)89, homozygous for Smn1 null and harboring the U7-ESE-B transgene (SMN2+/+;Smn-/-;U7-ESE-B+) are called SMA/U7. The U7-ESE-B oligonucleotide has been shown to have nearly complete exon 7 inclusion into SMN1 and ~89% inclusion into SMN2 in cell culture models. The U7-ESE-B transgene copy number is variable (see protocol information below), and SMA/U7 mice with higher U7-ESE-B copy number show greater phenotype rescue. Specifically, SMA/U7 mice with ~one U7-ESE-B transgene copy survive up to 3 weeks. SMA/U7 mice with ~five U7-ESE-B transgene copies exhibit life extension to more than one year, and an almost complete recovery of muscle functions and other disease parameters. The phenotype described above is for SMA/U7 mice on a mixed FVB/N, C57BL/6J, DBA/2J genetic background. The donating investigator reports that this mixed background generally results in a more severe SMA phenotype when compared to mice of the same genotype on an FVB genetic background. EGFP fluorescence is observed in blood samples.

The donating investigator's qPCR protocol for quantifying the U7-ESE-B transgene copy number is available here.

Development

The SMA/U7 mice harbor several mutations/transgenes, as described below.

Creation of the Tg(SMN2)89 transgene (SMN2) and Smn1 null allele (Smn1^tm1Msd; also called Smn-) are described for the severe type I SMA mouse model on an FVB/NJ background (JAX Stock No. 005024). The Tg(SMN2)89 transgene insertion site is on chromosome 6. These FVB.SMN2;Smn- mice were maintained on an FVB/NJ background prior to being used as below.

The U7-ESE-B transgenic mice were created by Dr. Daniel Schuemperli (Institute of Cell Biology [IZB], University of Bern, Switzerland) using a lentiviral transgenic approach. The U7-ESE-B splicing correction cassette encodes a tailed antisense oligonucleotide directed to the 3prime part of human SMN2 exon 7 and an additional splicing enhancer sequence. To create this cassette, a 570 bp region of the U7 wildtype gene (Rnu7) was obtained containing 341 bp 5prime flanking sequence (including the distal and proximal sequence promoter elements [DSE and PSE]), 62 bp U7 snRNA coding region and 167 bp 3prime sequence (including the 3prime box). Next, several in vitro modifications were made within the U7 snRNA coding region, as detailed below. The 5’GGA non-complementary "tail" sequence (GGAGGACGGAGGACGGAGGAC), predicted to mimic the exonic splicing enhancer (ESE) sequence of an SF2/ASF/SRSF1 binding site, was introduced. The antisense sequence complementary to the histone downstream element in replication-dependent histone pre-mRNAs was changed to a sequence binding to positions 33-50 in the 3prime region (position B [also called B1]) of the weak exon 7 of human SMN2. The Sm binding site (aatttGtCT) was changed to the Sm OPT sequence (aatttTtGG ; corresponding to the consensus sequence found in spliceosomal snRNAs). As a consequence, the resulting snRNA no longer binds the U7-specific Sm-like proteins Lsm10 and Lsm11, but rather the five standard Sm proteins found in spliceosomal snRNPs. These changes in snRNP assembly render the RNA non-functional for histone RNA processing and additionally allow it to accumulate in cell nuclei ~3 times more efficiently.
The resulting U7-ESE-B splicing correction cassette was introduced into the third generation (self-inactivating) lentiviral vector pRRL-SIN-cPPT-hPGK-GFP-WPRE. The resulting ~4.4 kbp transgene had U7-ESE-B inserted upstream of the hPGK promoter and in sense orientation with EGFP. Lentiviral transgenesis was performed by perivitelline injection into B6D2G1 (derived from C57BL/6J x DBA/2J mice) fertilized oocytes. Founder female epfl-4 (brown coat color and 27.8 transgene copy number) was bred to a male FVB.SMN2;Smn- (JAX Stock No. 005024) to generate germline carriers. The triple mutant colony was maintained by breeding mice homozygous for the SMN2 transgene, heterozygous for the Smn1 null allele and harboring the U7-ESE-B transgene (SMN2+/+;Smn+/-;U7-ESE-B+) together for more than 15 generations. The colony was bred to FVB.SMN2;Smn- (JAX Stock No. 005024) for ~2-4 generations overall. The donating investigator reports U7-ESE-B transgene copy number is variable, selected breeders with higher copy number and suggests at least some of the transgene copies are linked. In 2016, SMN2+/+;Smn+/-;U7-ESE-B+ mice with ~8 copies of U7-ESE-B (and gray or white coat color) were sent to the Mutant Mouse Regional Resource Center node at The Jackson Laboratory (MMRRC-JAX).

The third generation lentiviral vector pRRL-SIN-cPPT-hPGK-GFP-WPRE is composed of U3 sequences from Rous sarcoma virus (RSV-RU5), HIV-1 packaging signal (Ψ), HIV-1 central polypurine tract (cPPT), human phosphoglycerate kinase promoter, enhanced green fluorescent protein gene (EGFP), woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) and self-inactivating deletions in the U3 region of the 3prime LTR.

Allele

Symbol: Smn1^tm1Msd
Name: targeted mutation 1, Michael Sendtner
MGI accession ID: MGI:2183946
Generation method: Targeted
Attributes: Reporter; Null/Knockout
Synonyms: SMN^-
Marker symbol: Smn1
Marker name: survival motor neuron 1
Marker synonyms: BCD541; C-BCD541; GEMIN1; SMA; SMA@; SMA1; SMA2; SMA3; SMA4; Smn; SMNC; SMNT; T-BCD541; TDRD16A; TDRD16B
Chromosome: 13
Strain of origin: 129P2/OlaHsd
Expressed genes: lacZ,beta-galactosidase,E. coli
Site of expression: The expression of the lacZ gene in tissues where Smn is normally expressed was noted.
Molecular note: A lacZ-neo cassette was inserted into exon 2 by homologous recombination resulting in an in-frame fusion of lacZ to exon 2. Homozygous mutant embryos were identified up to 80 hours post coitum. The expression of the lacZ gene in tissues where Smn is normally expressed was noted.

Allele

Symbol: Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch
Name: transgene insertion 4, Daniel Schuemperli
MGI accession ID: MGI:5767008
Generation method: Transgenic
Attributes: Reporter; Knockdown
Synonyms: U7-ESE-B
Marker symbol: Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch
Marker name: transgene insertion 4, Daniel Schuemperli
Chromosome: UN
Strain of origin: C57BL/6J x DBA/2J
Expressed genes: SMN2,survival of motor neuron 2, centromeric,human; GFP,Green Fluorescent Protein,
Site of expression: EGFP fluorescence is observed in blood samples.
Molecular note: The U7-ESE-B splicing correction cassette encodes a tailed antisense oligonucleotide directed to the 3' part of human SMN2 exon 7 and an additional splicing enhancer sequence. To create this cassette, a 570 bp region of the U7 wild-type gene (Rnu7) was obtained containing 341 bp 5' flanking sequence (including the distal and proximal sequence promoter elements [DSE and PSE]), 62 bp U7 snRNA coding region and 167 bp 3' sequence (including the 3' box). The 5'GGA non-complementary "tail" sequence (GGAGGACGGAGGACGGAGGAC), predicted to mimic the exonic splicing enhancer (ESE) sequence of an SF2/ASF/SRSF1 binding site, was introduced. The antisense sequence complementary to the histone downstream element in replication-dependent histone pre-mRNAs was changed to a sequence binding to positions 33-50 in the 3' region (position B [also called B1]) of the weak exon 7 of human SMN2. The Sm binding site (aatttGtCT) was changed to the Sm OPT sequence (aatttTtGG ; corresponding to the consensus sequence found in spliceosomal snRNAs). As a consequence, the resulting snRNA no longer binds the U7-specific Sm-like proteins Lsm10 and Lsm11 but rather the five standard Sm proteins found in spliceosomal snRNPs. These changes in snRNP assembly render the RNA non-functional for histone RNA processing and additionally allow it to accumulate in cell nuclei about 3 times more efficiently. The resulting U7-ESE-B splicing correction cassette was introduced into the third generation (self-inactivating) lentiviral vector pRRL-SIN-cPPT-hPGK-GFP-WPRE. The resulting approximate 4.4 kbp transgene had the U7-ESE-B inserted upstream of the hPGK promoter and in sense orientation with EGFP. Line 4 has 8 copies of the transgene.

Allele

Symbol: Grm7^{Tg(SMN2)89Ahmb}
Name: transgene insertion 89, Arthur H M Burghes
MGI accession ID: MGI:2448989
Generation method: Transgenic
Attributes: Hypomorph; Inserted expressed sequence; Humanized sequence
Synonyms: SMN2; Tg(SMN2)89Ahmb
Marker symbol: Grm7
Marker name: glutamate receptor, metabotropic 7
Marker synonyms: 6330570A01Rik; E130018M02Rik; GLUR7; Gpr1g; GPRC1G; MGLU7; mGlu7a receptor; mGluR7; NEDSHBA; PPP1R87
Chromosome: 6
Strain of origin: FVB/N
Expressed genes: SMN2,survival of motor neuron 2, centromeric,human
Site of expression: Human SMN2 protein is expressed in the tissues examined (brain, liver, spinal cord) [Stock No. 005024].
Molecular note: A 35.5 kb genomic fragment containing the human survival motor neuron 2 (SMN2) gene and promoter was used for the transgene. The transgene is ubiquitously expressed in all tissues examined by Northern blot analysis. Line 89 carries 1 copy of the transgene integrated into intron 4 of the gene. RT-PCR confirmed reduced expression of the gene the transgene is integrated into.