Protocol 31762: Standard PCR Assay - Edil3<Tg(Sox2-cre)1Amc>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 165 bp
Heterozygote = 165 bp and 207 bp
Wild type = 207 bp

>chr13:89451210+89451416 207bp CTTGTGTAGAGTGATGGCTTGA TAGTGCCCCATTTTTGAAGG

This assay may be capable of distinguishing hemi from hom.  Transgene integration site is known to be on mouse Chr 13.
This assay is designed around this insertion site, but it has not been tested on hom animals.
 
This assay is not able to be used for transgene copy number evaluation.  If this is required, it is suggested to type by qPCR.

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
37581 CTT GTG TAG AGT GAT GGC TTG A Wild type Forward A mChr13
37582 TAG TGC CCC ATT TTT GAA GG Common A mChr13
37583 CCA GTG CAG TGA AGC AAA TC Transgene Forward A Sox2

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
37581 0.50 uM
37582 0.50 uM
37583 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
039797 B6(CBA)-Chd8em3.1Lutzy/Mmjax
008454 B6.Cg-Edil3Tg(Sox2-cre)1Amc/J
034605 B6J(CBA)-Kcnn3em1.1Lutzy/Mmjax
014094 B6N.Cg-Edil3Tg(Sox2-cre)1Amc/J
026859 D2.Cg-Edil3Tg(Sox2-cre)1Amc/SjJ
004783 STOCK Edil3Tg(Sox2-cre)1Amc/J
6 strains use this protocol