B6J(CBA)-Kcnn3^em1.1Lutzy/Mmjax

Stock number: 034605
Product name: Kcnn3^V556F
Research areas: Cell Biology Research, Developmental Biology Research, Neurobiology Research

Description

Kcnn3^V556F knock-in mice express the clinical V556F gain of function mutation in the Kcnn3 (potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3) gene. These mice may be useful in studying Zimmermann–Laband Syndrome (VLS).

Mice with conditional expression of the V556F mutation are available as C57BL/6J-Kcnn3^em1Lutzy/Mmjax (MMRRC Stock No. 071600).

Detailed description

Kcnn3 (potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3) is expressed in the soma and dendrites of dopaminergic neurons in the substantia nigra and influences their action potential frequency. Defects in dopamine (DA) releasing neurons have been sighted in pathologies such as schizophrenia and Parkinson's disease. SK3 is also expressed in smooth muscle of the bladder and uterus, and endothelia of the vasculature where the channels participate in blood pressure regulation.

Kcnn3^V556F knock-in mice express the V556F mutation in exon 5. The clinical V555F gain of function mutation is associated with Zimmermann–Laband Syndrome (VLS), a cranial malformation syndrome. Mice heterozygous for the mutation are viable and fertile. The mutation is lethal in the homozygous state.

Mice with conditional expression of the V556F mutation are available as C57BL/6J-Kcnn3^em1Lutzy/Mmjax (MMRRC Stock No. 071600).

Development

This Kcnn3 knockin allele was generated using CRISPR/cas9 endonuclease-mediated genome editing. The targeting vector is designed to insert a loxP-flanked STOP cassette (which contains a splice acceptor and 3x SV40 polyadenylation sequence) upstream of a mutant exon 5 with a valine to phenylalanine (V556F, GTG to TTT) substitution at position 556 in the Kcnn3 (potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3) gene on chromosome 3. The mutation is located in the HA helix. PAM deletion mutations to eliminate recutting with CRISPR/cas9 were inserted in intron 4 and 5. Kcnn3 transcript Kcnn3-201 (ENSMUST00000000811.7) was used as reference for the exon number and guide sequences. Guides (GAAATGCCAACACTAAGCCT, AAATGCCAACACTAAGCCTG, ATGCACTCAGTAGGGGCATT, and CATGCACTCAGTAGGGGCAT), double-stranded plasmid donor and Cas9 nuclease were introduced into single cell C57BL/6J zygotes and transferred to pseudopregnant females. Progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6J mice for germline transmission. The colony was backcrossed to C57BL/6J for at least two generations. Mice were then crossed to B6.Cg-Edil3^{Tg(Sox2-cre)1Amc}/J to remove the LSL cassette. The cre allele was bred out of the strain.

Allele

Symbol: Kcnn3^em1.1Lutzy
Name: endonuclease-mediated mutation 1.1, Cathy Lutz
MGI accession ID: MGI:7526160
Generation method: Endonuclease-mediated
Attributes: Humanized sequence
Marker symbol: Kcnn3
Marker name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Marker synonyms: hSK3; KCa2.3; SK3; SKCA3; small conductance calcium-activated potassium channel 3; ZLS3
Chromosome: 3
Strain of origin: C57BL/6J
Molecular note: CRISPR/cas9 genome editing used guide RNAs (GAAATGCCAACACTAAGCCT, AAATGCCAACACTAAGCCTG, ATGCACTCAGTAGGGGCATT, and CATGCACTCAGTAGGGGCAT) to insert a loxP-flanked STOP cassette (which contains a splice acceptor and 3x SV40 polyadenylation sequence) upstream of a mutant exon 5 with a valine to phenylalanine (V556F, GTG to TTT) substitution at position 556 in the gene. The mutation is located in the HA helix. PAM deletion mutations to eliminate recutting with CRISPR/cas9 were inserted in intron 4 and 5. Kcnn3 transcript Kcnn3-201 (ENSMUST00000000811.7) was used as reference for the exon number and guide sequences. The orthologous clinical V555F gain of function mutation is associated with Zimmermann–Laband Syndrome (VLS), a cranial malformation syndrome. Cre-mediated recombination removed the LSL cassette.