For in-depth product & services help, ask our
Technical Information Scientists
Notes
This assay cannot distinguish hemi from hom
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Tg= 81 bp
IPC = 74 bp
Sequence
Tg Sequence: aggacggctgcttcatctacaaggtgaagttcatcggcgtgaacttcccctccgacggccccgtgatgcagaagaagacca
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37529 | AGG ACG GCT GCT TCA TCT AC | Transgene Forward | A | |||
| 37530 | TGG TCT TCT TCT GCA TCA CG | Transgene Reverse | A | |||
| 37531 | Fluorophore-1 | AGT TCA TCG GCG TGA ACT TC | Quencher-1 | Tg Probe | ||
| oIMR1544 | CAC GTG GGC TCC AGC ATT | Internal Positive Control Forward | A | |||
| oIMR3580 | TCA CCA GTC ATT TCT GCC TTT G | Internal Positive Control Reverse | A | |||
| TmoIMR0105 | Fluorophore-2 | CCA ATG GTC GGG CAC TGC TCA A | Quencher-2 | IC Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37529 | 0.40 uM |
| 37530 | 0.40 uM |
| oIMR1544 | 0.40 uM |
| oIMR3580 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 006055 | B6.Cg-Tg(CAG-Bgeo,-DsRed*MST)1Nagy/J |
| 006051 | B6.Cg-Tg(CAG-DsRed*MST)1Nagy/J |
| 008705 | B6.Cg-Tg(CAG-DsRed,-EGFP)5Gae/J |
| 006872 | B6.Cg-Tg(Ins1-DsRed*T4)32Hara/J |
| 018410 | B6.Cg-Tg(Pnkd*A7V*A9V,-DsRed)671Ljp/J |
| 013082 | B6.FVB-Tg(Per2-DsRed*T3)12Obr/Mmjax |
| 006679 | B6;129P2-Or8a1tm27Mom/MomJ |
| 029332 | B6N.Cg-Tg(P2rx4-tdTomato)1Khakh/J |
| 037280 | C57BL/6-Tg(Irgm1-DsRed2)1Nci/Mmjax |
| 009655 | C57BL/6J-Tg(Dcx-DsRed)14Qlu/J |
| 005328 | NOD/ShiLt-Tg(Cd4-DsRed)4Lt/J |
| 005438 | STOCK Tg(CAG-Bgeo,-DsRed*MST)1Nagy/J |
| 005441 | STOCK Tg(CAG-DsRed*MST)1Nagy/J |
| 008241 | STOCK Tg(Cspg4-DsRed.T1)1Akik/J |
| 14 strains use this protocol | |