Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 97 bp
Wild Type = 97 bp
GGCTtcttgGGGCA(G/A)CACTGGTGGGA
Mut =A
WT= G
>chr7:87429155-87429251 97bp ACTTGGAACAAGCCAGTCGT AGCCTACTGCTAAGCCCAGA
Wt Sequence:
Mutant Sequence:
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 36462 | ACT TGG AAC AAG CCA GTC GT | Forward | A | |||
| 36463 | AGC CTA CTG CTA AGC CCA GA | Reverse | A | |||
| 36464 | Fluorophore-1 | CTT GGG GCA GCA CTG GT | Quencher-1 | WT Probe | ||
| 36465 | Fluorophore-2 | TTC TTG GGG CAA CAC TGG T | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 36462 | 0.40 uM |
| 36463 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
| Stock Number | Strain Name |
|---|---|
| 034245 | FVB(129P2)-Pde6b+ Gtf2iem2Jdd Gtf2ird1em2Jdd Tyrc-ch/Mmjax |
| 034672 | FVB(129P2)-Pde6b+ Gtf2ird1em3Jdd Tyrc-ch/Mmjax |
| 004624 | FVB.129P2-Pde6b+ Tyrc-ch Fmr1tm1Cgr/J |
| 004828 | FVB.129P2-Pde6b+ Tyrc-ch/AntJ |
| 038293 | FVB.Cg-Pde6b+ Tyrc-ch Ccdc198em1Iad/J |
| 000271 | SH1/LeJ |
| 6 strains use this protocol | |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.